\
| Variant ID: vg0711963821 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 11963821 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCCATCCCACTCCATCACGCCCACCCTTGCCTAGATGCGTTGGCTAGAGGAAAGCTACACTACAAGCCTAGCTGTTGCCCACGCTGGCTTGTGGTAAGTA[C/T]
GAGGAATTCTTCCAGGGTTTCGCACGAACCGGTCCTTAATTGCCATGGGCACGACCATCAAAACCATGCACCCACAGCCCACCATTTAATGTATTTTAAT
ATTAAAATACATTAAATGGTGGGCTGTGGGTGCATGGTTTTGATGGTCGTGCCCATGGCAATTAAGGACCGGTTCGTGCGAAACCCTGGAAGAATTCCTC[G/A]
TACTTACCACAAGCCAGCGTGGGCAACAGCTAGGCTTGTAGTGTAGCTTTCCTCTAGCCAACGCATCTAGGCAAGGGTGGGCGTGATGGAGTGGGATGGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.80% | 7.60% | 0.55% | 0.00% | NA |
| All Indica | 2759 | 98.30% | 1.60% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 83.40% | 15.40% | 1.19% | 0.00% | NA |
| Aus | 269 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 5.20% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 72.20% | 25.40% | 2.35% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.50% | 14.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 25.00% | 69.80% | 5.21% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0711963821 | C -> T | LOC_Os07g20690.1 | upstream_gene_variant ; 4798.0bp to feature; MODIFIER | silent_mutation | Average:69.118; most accessible tissue: Minghui63 flag leaf, score: 82.75 | N | N | N | N |
| vg0711963821 | C -> T | LOC_Os07g20690-LOC_Os07g20700 | intergenic_region ; MODIFIER | silent_mutation | Average:69.118; most accessible tissue: Minghui63 flag leaf, score: 82.75 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0711963821 | NA | 1.23E-21 | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0711963821 | 2.89E-06 | NA | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0711963821 | NA | 4.58E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711963821 | 6.17E-06 | 6.17E-06 | mr1389 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711963821 | 1.09E-06 | NA | mr1627 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711963821 | NA | 4.62E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711963821 | NA | 2.50E-06 | mr1685 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711963821 | NA | 3.98E-07 | mr1038_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |