\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706378896:

Variant ID: vg0706378896 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6378896
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


GATCAGGCTGAGTACGACGACCATGCAGTGTGCAAAGCAAGTCTAGTGAACTTGTATTTTGATTTGTTTGATTGCTGGAGCTATGTAAATGAAACTATAC[C/T]
AGATACACGTACATCAACATGATGGAGCCAGGGATGTAGTTATGGGCAAACCGGCCAATTAATTATAGTTTGGGTTCTGAAGGTTTTGATTATGACTCAA

Reverse complement sequence

TTGAGTCATAATCAAAACCTTCAGAACCCAAACTATAATTAATTGGCCGGTTTGCCCATAACTACATCCCTGGCTCCATCATGTTGATGTACGTGTATCT[G/A]
GTATAGTTTCATTTACATAGCTCCAGCAATCAAACAAATCAAAATACAAGTTCACTAGACTTGCTTTGCACACTGCATGGTCGTCGTACTCAGCCTGATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.70% 10.90% 1.31% 0.00% NA
All Indica  2759 98.00% 1.20% 0.76% 0.00% NA
All Japonica  1512 66.50% 30.90% 2.65% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 96.80% 1.70% 1.51% 0.00% NA
Indica II  465 96.10% 3.40% 0.43% 0.00% NA
Indica III  913 99.60% 0.20% 0.22% 0.00% NA
Indica Intermediate  786 98.30% 0.60% 1.02% 0.00% NA
Temperate Japonica  767 51.10% 45.50% 3.39% 0.00% NA
Tropical Japonica  504 92.30% 7.30% 0.40% 0.00% NA
Japonica Intermediate  241 61.40% 33.60% 4.98% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706378896 C -> T LOC_Os07g11560.1 upstream_gene_variant ; 4151.0bp to feature; MODIFIER silent_mutation Average:52.34; most accessible tissue: Zhenshan97 young leaf, score: 74.675 N N N N
vg0706378896 C -> T LOC_Os07g11560-LOC_Os07g11580 intergenic_region ; MODIFIER silent_mutation Average:52.34; most accessible tissue: Zhenshan97 young leaf, score: 74.675 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706378896 NA 1.04E-09 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0706378896 NA 1.58E-13 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 NA 1.25E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 NA 1.36E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 NA 4.02E-07 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 3.01E-06 NA mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 2.37E-06 2.37E-06 mr1122 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 NA 3.14E-06 mr1149 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 NA 5.29E-06 mr1222 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 NA 2.08E-09 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 NA 7.82E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 NA 1.03E-06 mr1492 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 NA 4.17E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 NA 3.27E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 1.32E-06 NA mr1773 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 2.66E-06 2.66E-06 mr1773 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 1.95E-06 NA mr1797 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 9.66E-06 9.65E-06 mr1797 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 1.95E-06 NA mr1801 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 9.66E-06 9.65E-06 mr1801 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 3.60E-06 NA mr1802 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 2.39E-06 2.39E-06 mr1802 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 8.02E-06 8.01E-06 mr1824 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 NA 4.36E-06 mr1896 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706378896 NA 5.08E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251