Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702283955:

Variant ID: vg0702283955 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 2283955
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

GGCAGCGCCGTAGGCTGAAATGACGGTGAGACGGCCCTCTTGACAGAAGAGTCTTATACTCAAGCAATTCCTTACACTGATGAGATGAAACCAATTCAGG[G/A]
AGAAAGCTTAAAAAATAAAATACTGATGACATCCCATATTTTAGTGGTGCAATCAATATAGAAAACATTGTCATTATATTCATCAGAACTTGGACATGAT

Reverse complement sequence

ATCATGTCCAAGTTCTGATGAATATAATGACAATGTTTTCTATATTGATTGCACCACTAAAATATGGGATGTCATCAGTATTTTATTTTTTAAGCTTTCT[C/T]
CCTGAATTGGTTTCATCTCATCAGTGTAAGGAATTGCTTGAGTATAAGACTCTTCTGTCAAGAGGGCCGTCTCACCGTCATTTCAGCCTACGGCGCTGCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.30%	19.50%	1.18%	0.00%	NA
All Indica	2759	89.50%	10.10%	0.43%	0.00%	NA
All Japonica	1512	61.00%	36.40%	2.51%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	54.80%	44.30%	0.86%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	90.10%	8.90%	1.02%	0.00%	NA
Temperate Japonica	767	94.50%	3.80%	1.69%	0.00%	NA
Tropical Japonica	504	18.70%	77.40%	3.97%	0.00%	NA
Japonica Intermediate	241	43.20%	54.80%	2.07%	0.00%	NA
VI/Aromatic	96	30.20%	68.80%	1.04%	0.00%	NA
Intermediate	90	64.40%	30.00%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0702283955	G -> A	LOC_Os07g05160.1	upstream_gene_variant ; 2907.0bp to feature; MODIFIER	silent_mutation	Average:35.634; most accessible tissue: Callus, score: 64.047	N	N	N	N
vg0702283955	G -> A	LOC_Os07g05150.1	downstream_gene_variant ; 1893.0bp to feature; MODIFIER	silent_mutation	Average:35.634; most accessible tissue: Callus, score: 64.047	N	N	N	N
vg0702283955	G -> A	LOC_Os07g05145-LOC_Os07g05150	intergenic_region ; MODIFIER	silent_mutation	Average:35.634; most accessible tissue: Callus, score: 64.047	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0702283955	NA	4.66E-14	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0702283955	NA	5.12E-06	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	1.79E-06	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	1.05E-08	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	7.25E-07	mr1216	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	3.13E-12	mr1454	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	8.74E-06	mr1479	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	6.38E-09	mr1502	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	3.54E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	6.05E-08	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	8.59E-09	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	2.08E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	1.95E-07	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	2.15E-06	mr1742	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	5.48E-06	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	1.33E-08	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	5.03E-06	mr1975	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	3.38E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	1.61E-09	mr1995	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	2.46E-07	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	7.45E-12	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	4.74E-07	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	7.68E-07	mr1268_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	2.40E-11	mr1383_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702283955	NA	1.03E-08	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251