Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700004041:

Variant ID: vg0700004041 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 4041
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, G: 0.11, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTGCACTCAAGCTATATTTTCATGTGTTGTAGCCTTCGGATAAAACACGTGAGTCTTAAACTTTGAGAAAAAATGCAAGAATTATTCCTCCAACCCA[A/G]
AATTTCACTTGTATTAGCATCAAAGATCGTTGCACATGAAGCATGTGGATATTTCAATTACAACAAAATAATATTTGTGATTTTTGCATTCTATCTATAT

Reverse complement sequence

ATATAGATAGAATGCAAAAATCACAAATATTATTTTGTTGTAATTGAAATATCCACATGCTTCATGTGCAACGATCTTTGATGCTAATACAAGTGAAATT[T/C]
TGGGTTGGAGGAATAATTCTTGCATTTTTTCTCAAAGTTTAAGACTCACGTGTTTTATCCGAAGGCTACAACACATGAAAATATAGCTTGAGTGCAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	23.00%	19.70%	3.05%	54.21%	NA
All Indica	2759	12.50%	1.60%	4.64%	81.23%	NA
All Japonica	1512	40.90%	56.90%	0.07%	2.05%	NA
Aus	269	0.40%	1.10%	5.20%	93.31%	NA
Indica I	595	0.70%	2.00%	2.86%	94.45%	NA
Indica II	465	51.20%	1.50%	1.29%	46.02%	NA
Indica III	913	0.30%	1.40%	9.42%	88.83%	NA
Indica Intermediate	786	12.80%	1.50%	2.42%	83.21%	NA
Temperate Japonica	767	15.40%	84.20%	0.13%	0.26%	NA
Tropical Japonica	504	68.70%	26.00%	0.00%	5.36%	NA
Japonica Intermediate	241	64.30%	34.90%	0.00%	0.83%	NA
VI/Aromatic	96	87.50%	1.00%	1.04%	10.42%	NA
Intermediate	90	41.10%	26.70%	0.00%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0700004041	A -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700004041	A -> G	LOC_Os07g01010.1	downstream_gene_variant ; 907.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700004041	A -> G	LOC_Os07g01010-LOC_Os07g01020	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0700004041	NA	3.64E-15	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0700004041	NA	3.01E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700004041	1.48E-06	9.65E-09	mr1277	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700004041	NA	1.88E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700004041	NA	4.75E-06	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700004041	NA	4.24E-06	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700004041	NA	1.18E-06	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251