\
| Variant ID: vg0700004041 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 4041 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, G: 0.11, others allele: 0.00, population size: 104. )
TTTTTGCACTCAAGCTATATTTTCATGTGTTGTAGCCTTCGGATAAAACACGTGAGTCTTAAACTTTGAGAAAAAATGCAAGAATTATTCCTCCAACCCA[A/G]
AATTTCACTTGTATTAGCATCAAAGATCGTTGCACATGAAGCATGTGGATATTTCAATTACAACAAAATAATATTTGTGATTTTTGCATTCTATCTATAT
ATATAGATAGAATGCAAAAATCACAAATATTATTTTGTTGTAATTGAAATATCCACATGCTTCATGTGCAACGATCTTTGATGCTAATACAAGTGAAATT[T/C]
TGGGTTGGAGGAATAATTCTTGCATTTTTTCTCAAAGTTTAAGACTCACGTGTTTTATCCGAAGGCTACAACACATGAAAATATAGCTTGAGTGCAAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 23.00% | 19.70% | 3.05% | 54.21% | NA |
| All Indica | 2759 | 12.50% | 1.60% | 4.64% | 81.23% | NA |
| All Japonica | 1512 | 40.90% | 56.90% | 0.07% | 2.05% | NA |
| Aus | 269 | 0.40% | 1.10% | 5.20% | 93.31% | NA |
| Indica I | 595 | 0.70% | 2.00% | 2.86% | 94.45% | NA |
| Indica II | 465 | 51.20% | 1.50% | 1.29% | 46.02% | NA |
| Indica III | 913 | 0.30% | 1.40% | 9.42% | 88.83% | NA |
| Indica Intermediate | 786 | 12.80% | 1.50% | 2.42% | 83.21% | NA |
| Temperate Japonica | 767 | 15.40% | 84.20% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 68.70% | 26.00% | 0.00% | 5.36% | NA |
| Japonica Intermediate | 241 | 64.30% | 34.90% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 87.50% | 1.00% | 1.04% | 10.42% | NA |
| Intermediate | 90 | 41.10% | 26.70% | 0.00% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0700004041 | A -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700004041 | A -> G | LOC_Os07g01010.1 | downstream_gene_variant ; 907.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700004041 | A -> G | LOC_Os07g01010-LOC_Os07g01020 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0700004041 | NA | 3.64E-15 | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0700004041 | NA | 3.01E-07 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700004041 | 1.48E-06 | 9.65E-09 | mr1277 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700004041 | NA | 1.88E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700004041 | NA | 4.75E-06 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700004041 | NA | 4.24E-06 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700004041 | NA | 1.18E-06 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |