Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627387528:

Variant ID: vg0627387528 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 27387528
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.68, G: 0.32, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

GGTAAAATCTCTCTCCCTTTTTTAAAGAGGGATAAAATTACTTTAAACATGTTAAGATTTCAAATTATACTATTAGACACTGAAAAACAGTATGCACAGG[G/A]
AAAAATCATGTCTTGTTTCCCGAAAGAGCTAATATTCTGACAAATGGTTAGGCAGTAGATTGTACAACGCCAAGAACAATGAATAATTTGTACAACACGA

Reverse complement sequence

TCGTGTTGTACAAATTATTCATTGTTCTTGGCGTTGTACAATCTACTGCCTAACCATTTGTCAGAATATTAGCTCTTTCGGGAAACAAGACATGATTTTT[C/T]
CCTGTGCATACTGTTTTTCAGTGTCTAATAGTATAATTTGAAATCTTAACATGTTTAAAGTAATTTTATCCCTCTTTAAAAAAGGGAGAGAGATTTTACC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.10%	37.90%	0.06%	0.00%	NA
All Indica	2759	98.60%	1.40%	0.00%	0.00%	NA
All Japonica	1512	1.20%	98.80%	0.00%	0.00%	NA
Aus	269	56.10%	43.10%	0.74%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	99.10%	0.90%	0.00%	0.00%	NA
Indica Intermediate	786	96.70%	3.30%	0.00%	0.00%	NA
Temperate Japonica	767	1.60%	98.40%	0.00%	0.00%	NA
Tropical Japonica	504	0.80%	99.20%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	45.60%	53.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0627387528	G -> A	LOC_Os06g45300.1	downstream_gene_variant ; 669.0bp to feature; MODIFIER	silent_mutation	Average:75.764; most accessible tissue: Zhenshan97 flower, score: 85.885	N	N	N	N
vg0627387528	G -> A	LOC_Os06g45310.1	downstream_gene_variant ; 9.0bp to feature; MODIFIER	silent_mutation	Average:75.764; most accessible tissue: Zhenshan97 flower, score: 85.885	N	N	N	N
vg0627387528	G -> A	LOC_Os06g45300.2	downstream_gene_variant ; 669.0bp to feature; MODIFIER	silent_mutation	Average:75.764; most accessible tissue: Zhenshan97 flower, score: 85.885	N	N	N	N
vg0627387528	G -> A	LOC_Os06g45300-LOC_Os06g45310	intergenic_region ; MODIFIER	silent_mutation	Average:75.764; most accessible tissue: Zhenshan97 flower, score: 85.885	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0627387528	NA	1.00E-19	Yield	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0627387528	NA	7.33E-41	mr1509	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627387528	NA	2.30E-49	mr1558	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627387528	NA	5.44E-43	mr1591	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627387528	NA	1.44E-61	mr1671	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627387528	NA	3.36E-13	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627387528	NA	2.54E-28	mr1793	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627387528	NA	3.86E-26	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627387528	NA	8.48E-71	mr1087_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627387528	NA	1.62E-73	mr1088_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627387528	NA	1.94E-50	mr1404_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627387528	NA	5.97E-16	mr1457_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627387528	NA	2.16E-47	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627387528	NA	7.20E-44	mr1509_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627387528	NA	8.74E-57	mr1558_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627387528	NA	4.97E-22	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627387528	NA	5.77E-92	mr1671_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627387528	NA	6.40E-45	mr1793_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627387528	NA	1.12E-30	mr1913_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251