\
| Variant ID: vg0627174899 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 27174899 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.30, others allele: 0.00, population size: 97. )
ATAAATAGAGGACTTATTTACCTTAACTTAGGTTGCAACTCAGAACAGCCCGAGAATGCAACCGACGACACAGACGAGGAAACACCAACAACAGCAGCAG[T/C]
GGCGGAACCAACGAACTAACACCCAAACACCACAGGCGATGGCTAGGAACCAGGACGAAACCCTAATCTTCACTTCACTTCATCTTCACTTTAAGGCGGA
TCCGCCTTAAAGTGAAGATGAAGTGAAGTGAAGATTAGGGTTTCGTCCTGGTTCCTAGCCATCGCCTGTGGTGTTTGGGTGTTAGTTCGTTGGTTCCGCC[A/G]
CTGCTGCTGTTGTTGGTGTTTCCTCGTCTGTGTCGTCGGTTGCATTCTCGGGCTGTTCTGAGTTGCAACCTAAGTTAAGGTAAATAAGTCCTCTATTTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.60% | 40.60% | 0.78% | 0.00% | NA |
| All Indica | 2759 | 92.80% | 6.50% | 0.72% | 0.00% | NA |
| All Japonica | 1512 | 0.50% | 99.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 56.90% | 37.20% | 5.95% | 0.00% | NA |
| Indica I | 595 | 97.30% | 1.30% | 1.34% | 0.00% | NA |
| Indica II | 465 | 93.10% | 5.20% | 1.72% | 0.00% | NA |
| Indica III | 913 | 88.80% | 11.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.80% | 5.70% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.00% | 99.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 53.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0627174899 | T -> C | LOC_Os06g44940.1 | upstream_gene_variant ; 4530.0bp to feature; MODIFIER | silent_mutation | Average:62.65; most accessible tissue: Minghui63 flower, score: 78.979 | N | N | N | N |
| vg0627174899 | T -> C | LOC_Os06g44930-LOC_Os06g44940 | intergenic_region ; MODIFIER | silent_mutation | Average:62.65; most accessible tissue: Minghui63 flower, score: 78.979 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0627174899 | NA | 1.23E-18 | Yield | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0627174899 | NA | 2.47E-30 | mr1086 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627174899 | NA | 5.99E-07 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627174899 | NA | 2.85E-06 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627174899 | NA | 7.30E-52 | mr1154 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627174899 | NA | 6.33E-08 | mr1154 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627174899 | NA | 6.54E-06 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627174899 | NA | 1.90E-12 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627174899 | NA | 1.04E-33 | mr1878 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627174899 | NA | 4.44E-08 | mr1246_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627174899 | NA | 6.82E-27 | mr1323_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627174899 | NA | 4.99E-50 | mr1404_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627174899 | NA | 2.98E-06 | mr1404_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627174899 | NA | 5.33E-07 | mr1620_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627174899 | NA | 5.43E-36 | mr1878_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |