Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0624681286:

Variant ID: vg0624681286 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 24681286
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTGGGAAGAGGAAAGAGGAGAGGAGAGAAGAAAAAGACATAGCGAGGAAAGGAGAGAAAGAGGGGAAAATTTAAAGTGGGTAAGAGGGAAAGAGGGAGT[C/G]
GGTATTTTTGCGTGCGGCACTTTTAATAGGTCCGCCCGTGAAAATAGGCTCAGTTTCCGTGCGGTCCTCTTAAATGGACCGCACGCGAAAATAAGCTTAT

Reverse complement sequence

ATAAGCTTATTTTCGCGTGCGGTCCATTTAAGAGGACCGCACGGAAACTGAGCCTATTTTCACGGGCGGACCTATTAAAAGTGCCGCACGCAAAAATACC[G/C]
ACTCCCTCTTTCCCTCTTACCCACTTTAAATTTTCCCCTCTTTCTCTCCTTTCCTCGCTATGTCTTTTTCTTCTCTCCTCTCCTCTTTCCTCTTCCCAGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.00%	29.90%	1.06%	4.02%	NA
All Indica	2759	91.60%	6.90%	0.25%	1.23%	NA
All Japonica	1512	29.70%	57.90%	2.58%	9.79%	NA
Aus	269	15.60%	83.60%	0.74%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	93.80%	3.90%	0.22%	2.15%	NA
Indica III	913	88.30%	11.40%	0.22%	0.11%	NA
Indica Intermediate	786	87.90%	8.70%	0.51%	2.93%	NA
Temperate Japonica	767	47.10%	48.60%	4.04%	0.26%	NA
Tropical Japonica	504	7.10%	64.90%	0.79%	27.18%	NA
Japonica Intermediate	241	21.60%	73.00%	1.66%	3.73%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	56.70%	32.20%	2.22%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0624681286	C -> G	LOC_Os06g41240.1	upstream_gene_variant ; 57.0bp to feature; MODIFIER	silent_mutation	Average:59.896; most accessible tissue: Callus, score: 97.628	N	N	N	N
vg0624681286	C -> G	LOC_Os06g41250.1	upstream_gene_variant ; 2987.0bp to feature; MODIFIER	silent_mutation	Average:59.896; most accessible tissue: Callus, score: 97.628	N	N	N	N
vg0624681286	C -> G	LOC_Os06g41240-LOC_Os06g41250	intergenic_region ; MODIFIER	silent_mutation	Average:59.896; most accessible tissue: Callus, score: 97.628	N	N	N	N
vg0624681286	C -> DEL	N	N	silent_mutation	Average:59.896; most accessible tissue: Callus, score: 97.628	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0624681286	1.13E-06	9.54E-23	Yield	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0624681286	NA	2.57E-06	Yield	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0624681286	NA	1.30E-15	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624681286	NA	7.20E-10	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624681286	NA	1.05E-07	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624681286	NA	8.70E-22	mr1164_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624681286	NA	4.02E-13	mr1330_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624681286	NA	5.66E-07	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624681286	NA	1.39E-09	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624681286	NA	1.81E-08	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624681286	NA	3.87E-14	mr1454_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624681286	NA	4.14E-19	mr1531_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624681286	NA	2.40E-08	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624681286	NA	2.03E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251