\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0624681286:

Variant ID: vg0624681286 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 24681286
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTGGGAAGAGGAAAGAGGAGAGGAGAGAAGAAAAAGACATAGCGAGGAAAGGAGAGAAAGAGGGGAAAATTTAAAGTGGGTAAGAGGGAAAGAGGGAGT[C/G]
GGTATTTTTGCGTGCGGCACTTTTAATAGGTCCGCCCGTGAAAATAGGCTCAGTTTCCGTGCGGTCCTCTTAAATGGACCGCACGCGAAAATAAGCTTAT

Reverse complement sequence

ATAAGCTTATTTTCGCGTGCGGTCCATTTAAGAGGACCGCACGGAAACTGAGCCTATTTTCACGGGCGGACCTATTAAAAGTGCCGCACGCAAAAATACC[G/C]
ACTCCCTCTTTCCCTCTTACCCACTTTAAATTTTCCCCTCTTTCTCTCCTTTCCTCGCTATGTCTTTTTCTTCTCTCCTCTCCTCTTTCCTCTTCCCAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.00% 29.90% 1.06% 4.02% NA
All Indica  2759 91.60% 6.90% 0.25% 1.23% NA
All Japonica  1512 29.70% 57.90% 2.58% 9.79% NA
Aus  269 15.60% 83.60% 0.74% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 93.80% 3.90% 0.22% 2.15% NA
Indica III  913 88.30% 11.40% 0.22% 0.11% NA
Indica Intermediate  786 87.90% 8.70% 0.51% 2.93% NA
Temperate Japonica  767 47.10% 48.60% 4.04% 0.26% NA
Tropical Japonica  504 7.10% 64.90% 0.79% 27.18% NA
Japonica Intermediate  241 21.60% 73.00% 1.66% 3.73% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 56.70% 32.20% 2.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0624681286 C -> G LOC_Os06g41240.1 upstream_gene_variant ; 57.0bp to feature; MODIFIER silent_mutation Average:59.896; most accessible tissue: Callus, score: 97.628 N N N N
vg0624681286 C -> G LOC_Os06g41250.1 upstream_gene_variant ; 2987.0bp to feature; MODIFIER silent_mutation Average:59.896; most accessible tissue: Callus, score: 97.628 N N N N
vg0624681286 C -> G LOC_Os06g41240-LOC_Os06g41250 intergenic_region ; MODIFIER silent_mutation Average:59.896; most accessible tissue: Callus, score: 97.628 N N N N
vg0624681286 C -> DEL N N silent_mutation Average:59.896; most accessible tissue: Callus, score: 97.628 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0624681286 1.13E-06 9.54E-23 Yield All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0624681286 NA 2.57E-06 Yield Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0624681286 NA 1.30E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624681286 NA 7.20E-10 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624681286 NA 1.05E-07 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624681286 NA 8.70E-22 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624681286 NA 4.02E-13 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624681286 NA 5.66E-07 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624681286 NA 1.39E-09 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624681286 NA 1.81E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624681286 NA 3.87E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624681286 NA 4.14E-19 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624681286 NA 2.40E-08 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624681286 NA 2.03E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251