\
| Variant ID: vg0624467444 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 24467444 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGCAGTCGCGCTAAGCGCTTCCCAAAAACATTATTGCCGCCTTCTCCCGGTGCAGGACGTCGAAGGTAGAGGTTCCGGAGACCTGCTCTCCCGATCGCCG[A/G]
TGCACGCCGGCGAGCGGGATGGAGTAATCTATGAGCGACGGCGCAGCACAGAGTAGGAGGCAAACCCTAGATTGATTTTTTCGTGTGTTGCGTGAAGACG
CGTCTTCACGCAACACACGAAAAAATCAATCTAGGGTTTGCCTCCTACTCTGTGCTGCGCCGTCGCTCATAGATTACTCCATCCCGCTCGCCGGCGTGCA[T/C]
CGGCGATCGGGAGAGCAGGTCTCCGGAACCTCTACCTTCGACGTCCTGCACCGGGAGAAGGCGGCAATAATGTTTTTGGGAAGCGCTTAGCGCGACTGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.10% | 10.90% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 66.80% | 33.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 45.50% | 54.20% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.00% | 22.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0624467444 | A -> G | LOC_Os06g40970.1 | downstream_gene_variant ; 3528.0bp to feature; MODIFIER | silent_mutation | Average:39.588; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0624467444 | A -> G | LOC_Os06g40980.1 | downstream_gene_variant ; 1201.0bp to feature; MODIFIER | silent_mutation | Average:39.588; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0624467444 | A -> G | LOC_Os06g40970-LOC_Os06g40980 | intergenic_region ; MODIFIER | silent_mutation | Average:39.588; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0624467444 | 3.95E-07 | NA | Yield | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0624467444 | NA | 2.85E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624467444 | NA | 2.03E-10 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624467444 | NA | 4.09E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624467444 | NA | 1.30E-07 | mr1946 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624467444 | NA | 1.44E-08 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624467444 | NA | 4.21E-07 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624467444 | NA | 5.81E-07 | mr1570_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624467444 | NA | 5.56E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624467444 | NA | 4.34E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624467444 | NA | 4.70E-07 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |