\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618886440:

Variant ID: vg0618886440 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18886440
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACATGTCTAATAATAAGTGTCTTATGGTGAATTCTCTCTATAAACGAAGAGAGATTTTATAAAATGTCTATAAGATTGTAGAGGCATTTTCTAGAGACA[T/C]
TAAATTGTACCACAACCATATAAAACCAGTCCAAAAAAGAGAATATAATAATATCCTTGCTTTTGTCAAGCCTTGATCTCTTGGTTAAATCATTTTAATC

Reverse complement sequence

GATTAAAATGATTTAACCAAGAGATCAAGGCTTGACAAAAGCAAGGATATTATTATATTCTCTTTTTTGGACTGGTTTTATATGGTTGTGGTACAATTTA[A/G]
TGTCTCTAGAAAATGCCTCTACAATCTTATAGACATTTTATAAAATCTCTCTTCGTTTATAGAGAGAATTCACCATAAGACACTTATTATTAGACATGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.50% 1.40% 2.39% 2.67% NA
All Indica  2759 99.50% 0.10% 0.14% 0.22% NA
All Japonica  1512 80.90% 4.20% 7.14% 7.74% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.30% 0.30% 0.50% 0.84% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.10% 0.13% 0.13% NA
Temperate Japonica  767 71.10% 6.40% 11.34% 11.21% NA
Tropical Japonica  504 96.80% 0.40% 1.39% 1.39% NA
Japonica Intermediate  241 78.80% 5.40% 5.81% 9.96% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 95.60% 1.10% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618886440 T -> C LOC_Os06g32470.1 upstream_gene_variant ; 3596.0bp to feature; MODIFIER silent_mutation Average:34.874; most accessible tissue: Callus, score: 57.757 N N N N
vg0618886440 T -> C LOC_Os06g32480.1 downstream_gene_variant ; 1113.0bp to feature; MODIFIER silent_mutation Average:34.874; most accessible tissue: Callus, score: 57.757 N N N N
vg0618886440 T -> C LOC_Os06g32490.1 downstream_gene_variant ; 3887.0bp to feature; MODIFIER silent_mutation Average:34.874; most accessible tissue: Callus, score: 57.757 N N N N
vg0618886440 T -> C LOC_Os06g32480-LOC_Os06g32490 intergenic_region ; MODIFIER silent_mutation Average:34.874; most accessible tissue: Callus, score: 57.757 N N N N
vg0618886440 T -> DEL N N silent_mutation Average:34.874; most accessible tissue: Callus, score: 57.757 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618886440 NA 1.93E-17 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0618886440 NA 1.21E-10 Heading_date All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0618886440 NA 1.91E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440 NA 2.18E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440 NA 5.19E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440 NA 8.11E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440 NA 9.04E-06 mr1049_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440 NA 4.48E-06 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440 NA 1.08E-06 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440 NA 4.85E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440 NA 5.56E-10 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440 NA 2.16E-08 mr1624_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440 4.29E-06 NA mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440 9.68E-06 NA mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440 8.12E-06 8.13E-06 mr1681_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440 NA 2.63E-06 mr1726_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440 NA 4.22E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440 NA 1.21E-06 mr1740_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440 NA 1.79E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440 NA 1.00E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440 NA 1.34E-07 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440 NA 3.66E-06 mr1792_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440 8.26E-06 8.26E-06 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251