Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618886440:

Variant ID: vg0618886440 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 18886440
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACATGTCTAATAATAAGTGTCTTATGGTGAATTCTCTCTATAAACGAAGAGAGATTTTATAAAATGTCTATAAGATTGTAGAGGCATTTTCTAGAGACA[T/C]
TAAATTGTACCACAACCATATAAAACCAGTCCAAAAAAGAGAATATAATAATATCCTTGCTTTTGTCAAGCCTTGATCTCTTGGTTAAATCATTTTAATC

Reverse complement sequence

GATTAAAATGATTTAACCAAGAGATCAAGGCTTGACAAAAGCAAGGATATTATTATATTCTCTTTTTTGGACTGGTTTTATATGGTTGTGGTACAATTTA[A/G]
TGTCTCTAGAAAATGCCTCTACAATCTTATAGACATTTTATAAAATCTCTCTTCGTTTATAGAGAGAATTCACCATAAGACACTTATTATTAGACATGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.50%	1.40%	2.39%	2.67%	NA
All Indica	2759	99.50%	0.10%	0.14%	0.22%	NA
All Japonica	1512	80.90%	4.20%	7.14%	7.74%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.30%	0.30%	0.50%	0.84%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.10%	0.13%	0.13%	NA
Temperate Japonica	767	71.10%	6.40%	11.34%	11.21%	NA
Tropical Japonica	504	96.80%	0.40%	1.39%	1.39%	NA
Japonica Intermediate	241	78.80%	5.40%	5.81%	9.96%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	95.60%	1.10%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0618886440	T -> C	LOC_Os06g32470.1	upstream_gene_variant ; 3596.0bp to feature; MODIFIER	silent_mutation	Average:34.874; most accessible tissue: Callus, score: 57.757	N	N	N	N
vg0618886440	T -> C	LOC_Os06g32480.1	downstream_gene_variant ; 1113.0bp to feature; MODIFIER	silent_mutation	Average:34.874; most accessible tissue: Callus, score: 57.757	N	N	N	N
vg0618886440	T -> C	LOC_Os06g32490.1	downstream_gene_variant ; 3887.0bp to feature; MODIFIER	silent_mutation	Average:34.874; most accessible tissue: Callus, score: 57.757	N	N	N	N
vg0618886440	T -> C	LOC_Os06g32480-LOC_Os06g32490	intergenic_region ; MODIFIER	silent_mutation	Average:34.874; most accessible tissue: Callus, score: 57.757	N	N	N	N
vg0618886440	T -> DEL	N	N	silent_mutation	Average:34.874; most accessible tissue: Callus, score: 57.757	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0618886440	NA	1.93E-17	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0618886440	NA	1.21E-10	Heading_date	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0618886440	NA	1.91E-08	mr1624	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440	NA	2.18E-06	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440	NA	5.19E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440	NA	8.11E-06	mr1043_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440	NA	9.04E-06	mr1049_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440	NA	4.48E-06	mr1167_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440	NA	1.08E-06	mr1456_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440	NA	4.85E-06	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440	NA	5.56E-10	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440	NA	2.16E-08	mr1624_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440	4.29E-06	NA	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440	9.68E-06	NA	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440	8.12E-06	8.13E-06	mr1681_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440	NA	2.63E-06	mr1726_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440	NA	4.22E-06	mr1736_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440	NA	1.21E-06	mr1740_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440	NA	1.79E-09	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440	NA	1.00E-06	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440	NA	1.34E-07	mr1780_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440	NA	3.66E-06	mr1792_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886440	8.26E-06	8.26E-06	mr1914_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251