\
| Variant ID: vg0615551230 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 15551230 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AATGAATACCGAATCCTTGGAAACAGTCTTGACGATAAGAACGTATTCGATGTGAGCAAAATAATGGGTGTCGAATCCTTGGAAACAGTCTTGACGACAC[G/A]
GACGTACCCGGAATAAAAAGAGAAAAAAAATATGAGCAAAAAGGCTCAAGATAAGAAAAGTCCAAAAAATTCTCTTGGTTATTTTGTGCTCAAGGTTATT
AATAACCTTGAGCACAAAATAACCAAGAGAATTTTTTGGACTTTTCTTATCTTGAGCCTTTTTGCTCATATTTTTTTTCTCTTTTTATTCCGGGTACGTC[C/T]
GTGTCGTCAAGACTGTTTCCAAGGATTCGACACCCATTATTTTGCTCACATCGAATACGTTCTTATCGTCAAGACTGTTTCCAAGGATTCGGTATTCATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.00% | 33.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 9.10% | 90.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 17.90% | 82.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.50% | 92.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 15.60% | 83.30% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 43.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0615551230 | G -> A | LOC_Os06g27460.1 | downstream_gene_variant ; 457.0bp to feature; MODIFIER | silent_mutation | Average:24.294; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0615551230 | G -> A | LOC_Os06g27470.1 | downstream_gene_variant ; 1938.0bp to feature; MODIFIER | silent_mutation | Average:24.294; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0615551230 | G -> A | LOC_Os06g27460-LOC_Os06g27470 | intergenic_region ; MODIFIER | silent_mutation | Average:24.294; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0615551230 | NA | 6.89E-19 | Yield | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0615551230 | NA | 4.02E-23 | mr1020 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615551230 | NA | 3.45E-20 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615551230 | NA | 3.12E-14 | mr1032 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615551230 | 4.11E-10 | 5.86E-79 | mr1033 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615551230 | NA | 2.04E-16 | mr1165 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615551230 | NA | 6.25E-40 | mr1176 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615551230 | NA | 2.45E-18 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615551230 | NA | 2.32E-06 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615551230 | NA | 1.48E-20 | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615551230 | NA | 6.05E-15 | mr1478 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615551230 | NA | 4.11E-75 | mr1536 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615551230 | NA | 9.09E-11 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615551230 | NA | 1.80E-21 | mr1971 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615551230 | NA | 1.04E-07 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615551230 | 1.78E-10 | 9.23E-104 | mr1033_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0615551230 | NA | 2.59E-96 | mr1536_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |