Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607207993:

Variant ID: vg0607207993 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 7207993
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATGTTATGATTCGGTTGTAACTATGCATCACTCTCGCAATGCTATTAACATGCTTACTACCTTTTTTTCAGGTGTCCTTAGTGACATGATAATAGGAGC[C/G]
TCTCAAGGAGGAGCTGATAGAATGATTGATTGATTTGCAATTACATTTGTTTTTAACTCTATATATAACTAGAAAAAATGACGTGCGTCGGTGAAGACTA

Reverse complement sequence

TAGTCTTCACCGACGCACGTCATTTTTTCTAGTTATATATAGAGTTAAAAACAAATGTAATTGCAAATCAATCAATCATTCTATCAGCTCCTCCTTGAGA[G/C]
GCTCCTATTATCATGTCACTAAGGACACCTGAAAAAAAGGTAGTAAGCATGTTAATAGCATTGCGAGAGTGATGCATAGTTACAACCGAATCATAACATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.80%	10.60%	1.16%	2.43%	NA
All Indica	2759	98.40%	0.00%	0.00%	1.56%	NA
All Japonica	1512	64.00%	32.30%	3.51%	0.26%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.00%	0.00%	0.22%	NA
Indica III	913	96.80%	0.00%	0.00%	3.18%	NA
Indica Intermediate	786	98.30%	0.00%	0.00%	1.65%	NA
Temperate Japonica	767	43.40%	50.60%	6.00%	0.00%	NA
Tropical Japonica	504	91.90%	7.30%	0.79%	0.00%	NA
Japonica Intermediate	241	71.00%	26.10%	1.24%	1.66%	NA
VI/Aromatic	96	33.30%	0.00%	1.04%	65.62%	NA
Intermediate	90	82.20%	12.20%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0607207993	C -> G	LOC_Os06g13120.1	upstream_gene_variant ; 3999.0bp to feature; MODIFIER	silent_mutation	Average:46.305; most accessible tissue: Callus, score: 83.228	N	N	N	N
vg0607207993	C -> G	LOC_Os06g13130.1	downstream_gene_variant ; 2176.0bp to feature; MODIFIER	silent_mutation	Average:46.305; most accessible tissue: Callus, score: 83.228	N	N	N	N
vg0607207993	C -> G	LOC_Os06g13140.1	downstream_gene_variant ; 1523.0bp to feature; MODIFIER	silent_mutation	Average:46.305; most accessible tissue: Callus, score: 83.228	N	N	N	N
vg0607207993	C -> G	LOC_Os06g13130-LOC_Os06g13140	intergenic_region ; MODIFIER	silent_mutation	Average:46.305; most accessible tissue: Callus, score: 83.228	N	N	N	N
vg0607207993	C -> DEL	N	N	silent_mutation	Average:46.305; most accessible tissue: Callus, score: 83.228	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0607207993	NA	9.97E-10	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0607207993	NA	8.47E-13	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0607207993	NA	5.53E-16	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0607207993	NA	9.49E-12	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0607207993	NA	6.01E-10	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607207993	NA	1.31E-07	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607207993	NA	1.98E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607207993	NA	2.22E-12	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607207993	NA	1.96E-07	mr1530	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607207993	NA	7.14E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607207993	NA	9.13E-14	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607207993	NA	3.06E-09	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607207993	NA	1.34E-07	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607207993	NA	1.06E-08	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607207993	NA	9.41E-14	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607207993	NA	5.44E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607207993	2.52E-06	NA	mr1530_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607207993	NA	3.22E-12	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607207993	NA	4.11E-09	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607207993	NA	1.71E-07	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251