Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604369775:

Variant ID: vg0604369775 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 4369775
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.87, C: 0.13, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

GTGGTGAATCTTCCACGGTGCCACCAATCCTCTACATTACATTTTCTAAAAACTAGCCCCTACAGTTTTTAGCATTACGGATTATAGTCCATTTATATAC[T/C]
GATTTGGCCTCCTTAAATTCAAATTTAGCAGTCATTTTTCATCCTTTCCACTCTTGCAGATGCACCCTAATTCAAACAGTGGAACAACTTCTATTTGCAT

Reverse complement sequence

ATGCAAATAGAAGTTGTTCCACTGTTTGAATTAGGGTGCATCTGCAAGAGTGGAAAGGATGAAAAATGACTGCTAAATTTGAATTTAAGGAGGCCAAATC[A/G]
GTATATAAATGGACTATAATCCGTAATGCTAAAAACTGTAGGGGCTAGTTTTTAGAAAATGTAATGTAGAGGATTGGTGGCACCGTGGAAGATTCACCAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.40%	42.50%	0.11%	0.00%	NA
All Indica	2759	61.20%	38.70%	0.11%	0.00%	NA
All Japonica	1512	40.90%	59.10%	0.07%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	37.00%	63.00%	0.00%	0.00%	NA
Indica II	465	51.40%	48.60%	0.00%	0.00%	NA
Indica III	913	79.50%	20.50%	0.00%	0.00%	NA
Indica Intermediate	786	64.10%	35.50%	0.38%	0.00%	NA
Temperate Japonica	767	4.20%	95.70%	0.13%	0.00%	NA
Tropical Japonica	504	90.30%	9.70%	0.00%	0.00%	NA
Japonica Intermediate	241	54.40%	45.60%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	57.80%	41.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0604369775	T -> C	LOC_Os06g08740.1	downstream_gene_variant ; 1191.0bp to feature; MODIFIER	silent_mutation	Average:68.868; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg0604369775	T -> C	LOC_Os06g08740.2	downstream_gene_variant ; 1191.0bp to feature; MODIFIER	silent_mutation	Average:68.868; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg0604369775	T -> C	LOC_Os06g08730.1	intron_variant ; MODIFIER	silent_mutation	Average:68.868; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0604369775	NA	9.98E-10	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0604369775	1.18E-08	1.20E-23	mr1115	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775	NA	3.38E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775	NA	2.63E-12	mr1241	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775	NA	5.10E-08	mr1552	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775	NA	9.63E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775	NA	3.18E-14	mr1611	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775	NA	2.20E-06	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775	NA	5.12E-14	mr1920	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775	NA	1.33E-09	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775	1.45E-06	NA	mr1115_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775	1.18E-07	1.10E-22	mr1115_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775	NA	8.23E-06	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775	4.57E-06	1.05E-17	mr1241_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775	NA	2.23E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775	NA	1.08E-09	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775	NA	1.47E-14	mr1611_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775	NA	6.56E-08	mr1629_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775	NA	1.17E-06	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251