\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604369775:

Variant ID: vg0604369775 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4369775
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.87, C: 0.13, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GTGGTGAATCTTCCACGGTGCCACCAATCCTCTACATTACATTTTCTAAAAACTAGCCCCTACAGTTTTTAGCATTACGGATTATAGTCCATTTATATAC[T/C]
GATTTGGCCTCCTTAAATTCAAATTTAGCAGTCATTTTTCATCCTTTCCACTCTTGCAGATGCACCCTAATTCAAACAGTGGAACAACTTCTATTTGCAT

Reverse complement sequence

ATGCAAATAGAAGTTGTTCCACTGTTTGAATTAGGGTGCATCTGCAAGAGTGGAAAGGATGAAAAATGACTGCTAAATTTGAATTTAAGGAGGCCAAATC[A/G]
GTATATAAATGGACTATAATCCGTAATGCTAAAAACTGTAGGGGCTAGTTTTTAGAAAATGTAATGTAGAGGATTGGTGGCACCGTGGAAGATTCACCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 42.50% 0.11% 0.00% NA
All Indica  2759 61.20% 38.70% 0.11% 0.00% NA
All Japonica  1512 40.90% 59.10% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 37.00% 63.00% 0.00% 0.00% NA
Indica II  465 51.40% 48.60% 0.00% 0.00% NA
Indica III  913 79.50% 20.50% 0.00% 0.00% NA
Indica Intermediate  786 64.10% 35.50% 0.38% 0.00% NA
Temperate Japonica  767 4.20% 95.70% 0.13% 0.00% NA
Tropical Japonica  504 90.30% 9.70% 0.00% 0.00% NA
Japonica Intermediate  241 54.40% 45.60% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 57.80% 41.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604369775 T -> C LOC_Os06g08740.1 downstream_gene_variant ; 1191.0bp to feature; MODIFIER silent_mutation Average:68.868; most accessible tissue: Minghui63 flower, score: 76.594 N N N N
vg0604369775 T -> C LOC_Os06g08740.2 downstream_gene_variant ; 1191.0bp to feature; MODIFIER silent_mutation Average:68.868; most accessible tissue: Minghui63 flower, score: 76.594 N N N N
vg0604369775 T -> C LOC_Os06g08730.1 intron_variant ; MODIFIER silent_mutation Average:68.868; most accessible tissue: Minghui63 flower, score: 76.594 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604369775 NA 9.98E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0604369775 1.18E-08 1.20E-23 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775 NA 3.38E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775 NA 2.63E-12 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775 NA 5.10E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775 NA 9.63E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775 NA 3.18E-14 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775 NA 2.20E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775 NA 5.12E-14 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775 NA 1.33E-09 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775 1.45E-06 NA mr1115_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775 1.18E-07 1.10E-22 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775 NA 8.23E-06 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775 4.57E-06 1.05E-17 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775 NA 2.23E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775 NA 1.08E-09 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775 NA 1.47E-14 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775 NA 6.56E-08 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604369775 NA 1.17E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251