Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0602041882:

Variant ID: vg0602041882 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 2041882
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCTGCAACAACTGCTACAACGTCTAACGTACTCCCTCCGTCCCATAATATAAAGGATTTTCAGTTTTTTCTTGCAACGTTTGACCACTCGTCTTATTCA[T/A]
TTTTTTTTTGCAAATATAAAAAACGAAAAGTTGTGCTTAAAGTACTGTAGATAATAAAGTAAGTTACAAATAAAATAATTAATAATTTCAAAAAAAATTA

Reverse complement sequence

TAATTTTTTTTGAAATTATTAATTATTTTATTTGTAACTTACTTTATTATCTACAGTACTTTAAGCACAACTTTTCGTTTTTTATATTTGCAAAAAAAAA[A/T]
TGAATAAGACGAGTGGTCAAACGTTGCAAGAAAAAACTGAAAATCCTTTATATTATGGGACGGAGGGAGTACGTTAGACGTTGTAGCAGTTGTTGCAGCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.70%	7.30%	6.14%	4.78%	NA
All Indica	2759	84.60%	0.70%	8.81%	5.98%	NA
All Japonica	1512	77.90%	21.70%	0.20%	0.20%	NA
Aus	269	72.50%	0.00%	14.13%	13.38%	NA
Indica I	595	73.40%	2.40%	10.92%	13.28%	NA
Indica II	465	89.20%	0.40%	7.31%	3.01%	NA
Indica III	913	91.80%	0.00%	6.57%	1.64%	NA
Indica Intermediate	786	81.80%	0.30%	10.69%	7.25%	NA
Temperate Japonica	767	62.20%	37.80%	0.00%	0.00%	NA
Tropical Japonica	504	96.00%	3.40%	0.60%	0.00%	NA
Japonica Intermediate	241	90.00%	8.70%	0.00%	1.24%	NA
VI/Aromatic	96	75.00%	0.00%	4.17%	20.83%	NA
Intermediate	90	94.40%	1.10%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0602041882	T -> A	LOC_Os06g04680.1	upstream_gene_variant ; 455.0bp to feature; MODIFIER	silent_mutation	Average:84.688; most accessible tissue: Minghui63 panicle, score: 92.38	N	N	N	N
vg0602041882	T -> A	LOC_Os06g04680.2	upstream_gene_variant ; 455.0bp to feature; MODIFIER	silent_mutation	Average:84.688; most accessible tissue: Minghui63 panicle, score: 92.38	N	N	N	N
vg0602041882	T -> A	LOC_Os06g04670.1	downstream_gene_variant ; 4104.0bp to feature; MODIFIER	silent_mutation	Average:84.688; most accessible tissue: Minghui63 panicle, score: 92.38	N	N	N	N
vg0602041882	T -> A	LOC_Os06g04690.1	downstream_gene_variant ; 1550.0bp to feature; MODIFIER	silent_mutation	Average:84.688; most accessible tissue: Minghui63 panicle, score: 92.38	N	N	N	N
vg0602041882	T -> A	LOC_Os06g04680-LOC_Os06g04690	intergenic_region ; MODIFIER	silent_mutation	Average:84.688; most accessible tissue: Minghui63 panicle, score: 92.38	N	N	N	N
vg0602041882	T -> DEL	N	N	silent_mutation	Average:84.688; most accessible tissue: Minghui63 panicle, score: 92.38	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0602041882	T	A	-0.01	0.0	0.0	0.0	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0602041882	9.79E-06	NA	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0602041882	NA	1.06E-07	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0602041882	NA	1.77E-11	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0602041882	NA	5.27E-07	mr1741	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602041882	NA	4.72E-09	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602041882	3.94E-07	NA	mr1164_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602041882	NA	3.80E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602041882	NA	3.81E-06	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602041882	NA	6.01E-09	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602041882	NA	8.07E-06	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602041882	NA	2.17E-07	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251