Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0529163752:

Variant ID: vg0529163752 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 29163752
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCACCCGTGTCGAGCGAATTTATTTTCCATGTGATTTTACTATCCTTAAAAATATACCATACTTTATAATGTAAAATTTAATATCTCCGGATACTAATTA[C/T]
CTCGATGTATTTTTTCAAGACTATAAATTTCTTAAATTATAGTCATACATACGGATGAGACACAATGGTCATGACAATGCGTGAAGCCTGTTGATGACTT

Reverse complement sequence

AAGTCATCAACAGGCTTCACGCATTGTCATGACCATTGTGTCTCATCCGTATGTATGACTATAATTTAAGAAATTTATAGTCTTGAAAAAATACATCGAG[G/A]
TAATTAGTATCCGGAGATATTAAATTTTACATTATAAAGTATGGTATATTTTTAAGGATAGTAAAATCACATGGAAAATAAATTCGCTCGACACGGGTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.90% 4.30% 0.85% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 84.50% 13.00% 2.45% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 71.30% 24.00% 4.69% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 95.40% 4.10% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 97.80% 0.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0529163752 C -> T LOC_Os05g50840.1 upstream_gene_variant ; 2084.0bp to feature; MODIFIER silent_mutation Average:93.881; most accessible tissue: Minghui63 flag leaf, score: 99.302 N N N N
vg0529163752 C -> T LOC_Os05g50840.2 upstream_gene_variant ; 2084.0bp to feature; MODIFIER silent_mutation Average:93.881; most accessible tissue: Minghui63 flag leaf, score: 99.302 N N N N
vg0529163752 C -> T LOC_Os05g50850.1 downstream_gene_variant ; 307.0bp to feature; MODIFIER silent_mutation Average:93.881; most accessible tissue: Minghui63 flag leaf, score: 99.302 N N N N
vg0529163752 C -> T LOC_Os05g50840-LOC_Os05g50850 intergenic_region ; MODIFIER silent_mutation Average:93.881; most accessible tissue: Minghui63 flag leaf, score: 99.302 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0529163752 C T 0.01 0.01 0.0 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0529163752 NA 2.85E-16 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0529163752 NA 3.22E-12 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0529163752 NA 1.40E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529163752 NA 8.77E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529163752 9.01E-06 9.91E-06 mr1412 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529163752 1.20E-06 1.20E-06 mr1412 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529163752 NA 5.68E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529163752 NA 4.39E-08 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529163752 NA 4.23E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529163752 NA 3.93E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529163752 NA 2.21E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529163752 NA 2.61E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529163752 NA 5.07E-10 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529163752 NA 2.38E-06 mr1576_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529163752 4.32E-06 2.42E-08 mr1749_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529163752 3.84E-06 5.42E-09 mr1821_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251