Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0528494070:

Variant ID: vg0528494070 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 28494070
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, G: 0.02, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


GGATAGTTGACGTGGCAGAGGGTAGCACCCACCGCCCACGCGGATCTTCTCTCTCTCTTCCCGTGCGCTCAAAAGCCCGGACTCAGCTTCGGTAACTTAG[C/G]
TAAGGCAAGTCACAGCATGACATATATGAATCTCGGCCGTCAAAAACGAATCCAACGGAGATGGCGCTTAGGCCTGCACGCAGGCAAAAAAAAAAAATCT

Reverse complement sequence

AGATTTTTTTTTTTTGCCTGCGTGCAGGCCTAAGCGCCATCTCCGTTGGATTCGTTTTTGACGGCCGAGATTCATATATGTCATGCTGTGACTTGCCTTA[G/C]
CTAAGTTACCGAAGCTGAGTCCGGGCTTTTGAGCGCACGGGAAGAGAGAGAGAAGATCCGCGTGGGCGGTGGGTGCTACCCTCTGCCACGTCAACTATCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.70% 24.00% 0.30% 0.00% NA
All Indica  2759 63.00% 36.60% 0.43% 0.00% NA
All Japonica  1512 95.40% 4.60% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 96.50% 3.50% 0.00% 0.00% NA
Indica II  465 50.50% 49.00% 0.43% 0.00% NA
Indica III  913 41.00% 58.60% 0.44% 0.00% NA
Indica Intermediate  786 70.60% 28.60% 0.76% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 1.80% 0.20% 0.00% NA
Japonica Intermediate  241 78.40% 21.60% 0.00% 0.00% NA
VI/Aromatic  96 60.40% 39.60% 0.00% 0.00% NA
Intermediate  90 80.00% 18.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0528494070 C -> G LOC_Os05g49680.1 upstream_gene_variant ; 214.0bp to feature; MODIFIER silent_mutation Average:97.618; most accessible tissue: Callus, score: 99.944 N N N N
vg0528494070 C -> G LOC_Os05g49684.1 upstream_gene_variant ; 116.0bp to feature; MODIFIER silent_mutation Average:97.618; most accessible tissue: Callus, score: 99.944 N N N N
vg0528494070 C -> G LOC_Os05g49690.1 upstream_gene_variant ; 3643.0bp to feature; MODIFIER silent_mutation Average:97.618; most accessible tissue: Callus, score: 99.944 N N N N
vg0528494070 C -> G LOC_Os05g49680-LOC_Os05g49684 intergenic_region ; MODIFIER silent_mutation Average:97.618; most accessible tissue: Callus, score: 99.944 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0528494070 C G 0.05 0.03 -0.01 0.03 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0528494070 NA 3.42E-21 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0528494070 NA 5.44E-18 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0528494070 NA 3.29E-12 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0528494070 NA 1.82E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528494070 NA 1.99E-06 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528494070 NA 4.21E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528494070 NA 2.94E-07 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528494070 3.40E-06 NA mr1933_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528494070 NA 1.40E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251