\
| Variant ID: vg0528383107 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 28383107 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 122. )
GATGATGCGATCATTGAACGTAGGCTTCTGACCAGGACAACAACTACCAGGAGTGAACCACCACTAAGGACAACATAGGCTGTGTTTAGAGGGTGTTTGG[G/A]
AAGTAGGGACTAAACTTTAGTCCCTCTCACAAAAGCATAAGGGGGTGTTTGGGAACTAGGGACTAAATTTAGTCCCTCTCACAAAAATATAAGTCCCTTT
AAAGGGACTTATATTTTTGTGAGAGGGACTAAATTTAGTCCCTAGTTCCCAAACACCCCCTTATGCTTTTGTGAGAGGGACTAAAGTTTAGTCCCTACTT[C/T]
CCAAACACCCTCTAAACACAGCCTATGTTGTCCTTAGTGGTGGTTCACTCCTGGTAGTTGTTGTCCTGGTCAGAAGCCTACGTTCAATGATCGCATCATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.60% | 7.80% | 1.65% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 71.80% | 23.20% | 4.96% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 53.10% | 38.50% | 8.47% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 74.30% | 22.00% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 6.20% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0528383107 | G -> A | LOC_Os05g49490.1 | downstream_gene_variant ; 4166.0bp to feature; MODIFIER | silent_mutation | Average:54.127; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0528383107 | G -> A | LOC_Os05g49500.1 | downstream_gene_variant ; 1471.0bp to feature; MODIFIER | silent_mutation | Average:54.127; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0528383107 | G -> A | LOC_Os05g49490-LOC_Os05g49500 | intergenic_region ; MODIFIER | silent_mutation | Average:54.127; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0528383107 | NA | 1.41E-12 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0528383107 | NA | 2.53E-13 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0528383107 | NA | 9.57E-06 | mr1126 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528383107 | NA | 1.71E-06 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528383107 | NA | 1.04E-06 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528383107 | NA | 1.44E-06 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528383107 | 6.03E-06 | 2.43E-10 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528383107 | NA | 2.10E-07 | mr1567_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528383107 | NA | 1.40E-06 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528383107 | NA | 3.01E-07 | mr1671_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528383107 | NA | 5.57E-07 | mr1680_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528383107 | 3.28E-06 | NA | mr1806_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528383107 | NA | 1.34E-10 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528383107 | NA | 2.04E-17 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0528383107 | NA | 3.60E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |