\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525819539:

Variant ID: vg0525819539 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 25819539
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGCGAGGGGCGTGGACTTAGGCTCCGTTCTTTAGTGGGAGTTGGGAACTCTCCCCCAAACACACAAAACGGAGTGGTCCATTAGCGTGTGATTAACCTA[C/A]
CATAGCCGGACCCGAGGGGATTGTATGGTTGAACCTTTGTCCAGAGCTACCATTTCCAGTAGCACAAAGTGATTTGGCAGTAGTTTCTGGGGATTTCTTG

Reverse complement sequence

CAAGAAATCCCCAGAAACTACTGCCAAATCACTTTGTGCTACTGGAAATGGTAGCTCTGGACAAAGGTTCAACCATACAATCCCCTCGGGTCCGGCTATG[G/T]
TAGGTTAATCACACGCTAATGGACCACTCCGTTTTGTGTGTTTGGGGGAGAGTTCCCAACTCCCACTAAAGAACGGAGCCTAAGTCCACGCCCCTCGCTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.60% 13.50% 0.87% 0.00% NA
All Indica  2759 99.60% 0.30% 0.18% 0.00% NA
All Japonica  1512 56.70% 41.00% 2.25% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.10% 1.30% 0.65% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.10% 0.25% 0.00% NA
Temperate Japonica  767 28.30% 68.20% 3.52% 0.00% NA
Tropical Japonica  504 95.40% 3.60% 0.99% 0.00% NA
Japonica Intermediate  241 66.40% 32.80% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 13.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0525819539 C -> A LOC_Os05g44360.1 upstream_gene_variant ; 2363.0bp to feature; MODIFIER silent_mutation Average:69.66; most accessible tissue: Zhenshan97 flower, score: 80.904 N N N N
vg0525819539 C -> A LOC_Os05g44360.2 upstream_gene_variant ; 3843.0bp to feature; MODIFIER silent_mutation Average:69.66; most accessible tissue: Zhenshan97 flower, score: 80.904 N N N N
vg0525819539 C -> A LOC_Os05g44370.1 downstream_gene_variant ; 248.0bp to feature; MODIFIER silent_mutation Average:69.66; most accessible tissue: Zhenshan97 flower, score: 80.904 N N N N
vg0525819539 C -> A LOC_Os05g44380.1 downstream_gene_variant ; 813.0bp to feature; MODIFIER silent_mutation Average:69.66; most accessible tissue: Zhenshan97 flower, score: 80.904 N N N N
vg0525819539 C -> A LOC_Os05g44390.1 downstream_gene_variant ; 4165.0bp to feature; MODIFIER silent_mutation Average:69.66; most accessible tissue: Zhenshan97 flower, score: 80.904 N N N N
vg0525819539 C -> A LOC_Os05g44370-LOC_Os05g44380 intergenic_region ; MODIFIER silent_mutation Average:69.66; most accessible tissue: Zhenshan97 flower, score: 80.904 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0525819539 NA 3.76E-12 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0525819539 NA 2.71E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0525819539 NA 5.24E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0525819539 NA 1.66E-15 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0525819539 NA 1.71E-11 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0525819539 NA 9.49E-08 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 6.10E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 2.27E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 2.92E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 4.00E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 1.13E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 7.81E-06 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 8.81E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 6.25E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 5.39E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 1.60E-06 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 4.55E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 2.42E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 2.65E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 4.32E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 3.75E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 1.87E-09 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 9.18E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 8.64E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 2.18E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 1.68E-09 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 8.49E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 1.23E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 3.76E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 1.45E-06 1.44E-06 mr1919_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525819539 NA 4.59E-06 mr1919_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251