Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525195530:

Variant ID: vg0525195530 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 25195530
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

TGGAGTAAGGTAACCTTCTCAAAATCCTCCTATATTTTCTTCATTTGGTGATTTGTTTTGGAGAAGAGCATGAACCCTAGGTTTGTCGTTTTTGTGAGAC[A/G]
AGGAAGATCGACTTCATTTATCGGTTAGGTGAGTTCTATAGGTTAATTTTGAGGGGATTTCATTCATCGGTACTGAACCCTAGTTGGTAGGATGGATTTG

Reverse complement sequence

CAAATCCATCCTACCAACTAGGGTTCAGTACCGATGAATGAAATCCCCTCAAAATTAACCTATAGAACTCACCTAACCGATAAATGAAGTCGATCTTCCT[T/C]
GTCTCACAAAAACGACAAACCTAGGGTTCATGCTCTTCTCCAAAACAAATCACCAAATGAAGAAAATATAGGAGGATTTTGAGAAGGTTACCTTACTCCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.60%	13.10%	1.33%	0.00%	NA
All Indica	2759	99.30%	0.50%	0.22%	0.00%	NA
All Japonica	1512	57.20%	39.20%	3.64%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	95.90%	2.80%	1.29%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	28.90%	67.40%	3.65%	0.00%	NA
Tropical Japonica	504	92.70%	4.60%	2.78%	0.00%	NA
Japonica Intermediate	241	73.00%	21.60%	5.39%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	10.00%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0525195530	A -> G	LOC_Os05g43300.1	downstream_gene_variant ; 2396.0bp to feature; MODIFIER	silent_mutation	Average:66.134; most accessible tissue: Minghui63 flag leaf, score: 85.67	N	N	N	N
vg0525195530	A -> G	LOC_Os05g43310.1	downstream_gene_variant ; 816.0bp to feature; MODIFIER	silent_mutation	Average:66.134; most accessible tissue: Minghui63 flag leaf, score: 85.67	N	N	N	N
vg0525195530	A -> G	LOC_Os05g43300.3	downstream_gene_variant ; 2435.0bp to feature; MODIFIER	silent_mutation	Average:66.134; most accessible tissue: Minghui63 flag leaf, score: 85.67	N	N	N	N
vg0525195530	A -> G	LOC_Os05g43300.2	downstream_gene_variant ; 2435.0bp to feature; MODIFIER	silent_mutation	Average:66.134; most accessible tissue: Minghui63 flag leaf, score: 85.67	N	N	N	N
vg0525195530	A -> G	LOC_Os05g43310-LOC_Os05g43330	intergenic_region ; MODIFIER	silent_mutation	Average:66.134; most accessible tissue: Minghui63 flag leaf, score: 85.67	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0525195530	NA	2.29E-10	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0525195530	NA	2.71E-12	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0525195530	NA	2.20E-16	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0525195530	NA	3.90E-13	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0525195530	NA	4.24E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530	NA	6.75E-06	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530	NA	1.16E-11	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530	NA	4.35E-09	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530	NA	9.76E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530	NA	7.91E-12	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530	NA	3.66E-07	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530	NA	6.78E-06	mr1060_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530	NA	1.08E-07	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530	NA	1.04E-06	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530	NA	5.00E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530	NA	1.04E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530	NA	6.38E-10	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530	NA	5.50E-06	mr1748_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530	3.69E-06	NA	mr1761_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530	NA	4.09E-07	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530	NA	3.81E-09	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251