\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525195530:

Variant ID: vg0525195530 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 25195530
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


TGGAGTAAGGTAACCTTCTCAAAATCCTCCTATATTTTCTTCATTTGGTGATTTGTTTTGGAGAAGAGCATGAACCCTAGGTTTGTCGTTTTTGTGAGAC[A/G]
AGGAAGATCGACTTCATTTATCGGTTAGGTGAGTTCTATAGGTTAATTTTGAGGGGATTTCATTCATCGGTACTGAACCCTAGTTGGTAGGATGGATTTG

Reverse complement sequence

CAAATCCATCCTACCAACTAGGGTTCAGTACCGATGAATGAAATCCCCTCAAAATTAACCTATAGAACTCACCTAACCGATAAATGAAGTCGATCTTCCT[T/C]
GTCTCACAAAAACGACAAACCTAGGGTTCATGCTCTTCTCCAAAACAAATCACCAAATGAAGAAAATATAGGAGGATTTTGAGAAGGTTACCTTACTCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.60% 13.10% 1.33% 0.00% NA
All Indica  2759 99.30% 0.50% 0.22% 0.00% NA
All Japonica  1512 57.20% 39.20% 3.64% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 95.90% 2.80% 1.29% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 28.90% 67.40% 3.65% 0.00% NA
Tropical Japonica  504 92.70% 4.60% 2.78% 0.00% NA
Japonica Intermediate  241 73.00% 21.60% 5.39% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 87.80% 10.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0525195530 A -> G LOC_Os05g43300.1 downstream_gene_variant ; 2396.0bp to feature; MODIFIER silent_mutation Average:66.134; most accessible tissue: Minghui63 flag leaf, score: 85.67 N N N N
vg0525195530 A -> G LOC_Os05g43310.1 downstream_gene_variant ; 816.0bp to feature; MODIFIER silent_mutation Average:66.134; most accessible tissue: Minghui63 flag leaf, score: 85.67 N N N N
vg0525195530 A -> G LOC_Os05g43300.3 downstream_gene_variant ; 2435.0bp to feature; MODIFIER silent_mutation Average:66.134; most accessible tissue: Minghui63 flag leaf, score: 85.67 N N N N
vg0525195530 A -> G LOC_Os05g43300.2 downstream_gene_variant ; 2435.0bp to feature; MODIFIER silent_mutation Average:66.134; most accessible tissue: Minghui63 flag leaf, score: 85.67 N N N N
vg0525195530 A -> G LOC_Os05g43310-LOC_Os05g43330 intergenic_region ; MODIFIER silent_mutation Average:66.134; most accessible tissue: Minghui63 flag leaf, score: 85.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0525195530 NA 2.29E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0525195530 NA 2.71E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0525195530 NA 2.20E-16 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0525195530 NA 3.90E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0525195530 NA 4.24E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530 NA 6.75E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530 NA 1.16E-11 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530 NA 4.35E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530 NA 9.76E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530 NA 7.91E-12 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530 NA 3.66E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530 NA 6.78E-06 mr1060_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530 NA 1.08E-07 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530 NA 1.04E-06 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530 NA 5.00E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530 NA 1.04E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530 NA 6.38E-10 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530 NA 5.50E-06 mr1748_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530 3.69E-06 NA mr1761_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530 NA 4.09E-07 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525195530 NA 3.81E-09 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251