Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521338672:

Variant ID: vg0521338672 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 21338672
Reference Allele: TAlternative Allele: G,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTACTGACTTCAAACGGTCGCCGAATCTGCATACGACCTCCGTTTTCGGCCCGTGAGTACTTGATGGAAAGCTCTTGGAGTCCTCTTTCCAATGGATCCA[T/G,A]
CCTCATTGTGAAATTCCATCTTATTGAGCCGCAATTGAAGCAACAAGTTGCCGCGTCACCTATAATGGGCCTATGGGCTTGTAACTTCGTATGGGACCCC

Reverse complement sequence

GGGGTCCCATACGAAGTTACAAGCCCATAGGCCCATTATAGGTGACGCGGCAACTTGTTGCTTCAATTGCGGCTCAATAAGATGGAATTTCACAATGAGG[A/C,T]
TGGATCCATTGGAAAGAGGACTCCAAGAGCTTTCCATCAAGTACTCACGGGCCGAAAACGGAGGTCGTATGCAGATTCGGCGACCGTTTGAAGTCAGTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.90% 14.20% 21.46% 6.39% A: 0.04%
All Indica  2759 58.90% 3.10% 27.65% 10.33% A: 0.04%
All Japonica  1512 53.40% 37.30% 9.19% 0.13% NA
Aus  269 58.70% 2.20% 34.20% 4.46% A: 0.37%
Indica I  595 27.40% 6.40% 38.66% 27.39% A: 0.17%
Indica II  465 73.10% 3.90% 17.20% 5.81% NA
Indica III  913 67.70% 0.40% 28.81% 3.07% NA
Indica Intermediate  786 64.00% 3.30% 24.17% 8.52% NA
Temperate Japonica  767 24.10% 63.10% 12.65% 0.13% NA
Tropical Japonica  504 92.30% 3.40% 4.17% 0.20% NA
Japonica Intermediate  241 65.10% 26.10% 8.71% 0.00% NA
VI/Aromatic  96 94.80% 1.00% 4.17% 0.00% NA
Intermediate  90 61.10% 17.80% 17.78% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0521338672 T -> DEL LOC_Os05g36040.1 N frameshift_variant Average:28.7; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0521338672 T -> G LOC_Os05g36040.1 missense_variant ; p.Ile533Ser; MODERATE nonsynonymous_codon ; I533S Average:28.7; most accessible tissue: Minghui63 panicle, score: 66.554 unknown unknown TOLERATED 1.00
vg0521338672 T -> A LOC_Os05g36040.1 missense_variant ; p.Ile533Asn; MODERATE nonsynonymous_codon ; I533N Average:28.7; most accessible tissue: Minghui63 panicle, score: 66.554 unknown unknown TOLERATED 0.15

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0521338672 NA 6.73E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0521338672 NA 4.20E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0521338672 NA 8.71E-16 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0521338672 NA 5.36E-16 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0521338672 NA 1.06E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 3.97E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 7.63E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 8.25E-06 mr1075 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 1.91E-07 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 9.93E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 1.67E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 1.54E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 2.06E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 2.19E-08 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 3.97E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 4.68E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 2.08E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 2.30E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 8.83E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 1.92E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 4.83E-11 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 1.36E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 1.56E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 1.65E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 2.18E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 2.17E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 9.14E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 7.02E-08 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 7.86E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 1.32E-06 NA mr1548_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 4.50E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 1.00E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 9.42E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 6.79E-13 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 2.16E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338672 NA 4.78E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251