\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0518842252:

Variant ID: vg0518842252 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 18842252
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.54, G: 0.46, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


AAGAGAAAGAAAGAGAGAAGGGAGGAAGAGGGGAGGAAGAAGAAAGAGAGAGCAGGACATGTGGGTGGCCCCACAATTTTTTTATGTGTGTGAATGACAA[A/G]
CGGGTCCCACATATACGTTTTTAATTCAAATGCCACCTAAGCACCACGTCAGCGAAACCGCCCTCAAAACCACAAAGGGAGTCAAATTACACCGGTTTTA

Reverse complement sequence

TAAAACCGGTGTAATTTGACTCCCTTTGTGGTTTTGAGGGCGGTTTCGCTGACGTGGTGCTTAGGTGGCATTTGAATTAAAAACGTATATGTGGGACCCG[T/C]
TTGTCATTCACACACATAAAAAAATTGTGGGGCCACCCACATGTCCTGCTCTCTCTTTCTTCTTCCTCCCCTCTTCCTCCCTTCTCTCTTTCTTTCTCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.70% 34.20% 0.06% 0.00% NA
All Indica  2759 98.70% 1.20% 0.11% 0.00% NA
All Japonica  1512 4.00% 96.00% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 98.20% 1.40% 0.38% 0.00% NA
Temperate Japonica  767 3.70% 96.30% 0.00% 0.00% NA
Tropical Japonica  504 5.40% 94.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 60.00% 40.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0518842252 A -> G LOC_Os05g32310.1 upstream_gene_variant ; 1431.0bp to feature; MODIFIER silent_mutation Average:95.995; most accessible tissue: Zhenshan97 flag leaf, score: 97.557 N N N N
vg0518842252 A -> G LOC_Os05g32320.1 upstream_gene_variant ; 499.0bp to feature; MODIFIER silent_mutation Average:95.995; most accessible tissue: Zhenshan97 flag leaf, score: 97.557 N N N N
vg0518842252 A -> G LOC_Os05g32330.1 downstream_gene_variant ; 3690.0bp to feature; MODIFIER silent_mutation Average:95.995; most accessible tissue: Zhenshan97 flag leaf, score: 97.557 N N N N
vg0518842252 A -> G LOC_Os05g32330.2 downstream_gene_variant ; 3690.0bp to feature; MODIFIER silent_mutation Average:95.995; most accessible tissue: Zhenshan97 flag leaf, score: 97.557 N N N N
vg0518842252 A -> G LOC_Os05g32310-LOC_Os05g32320 intergenic_region ; MODIFIER silent_mutation Average:95.995; most accessible tissue: Zhenshan97 flag leaf, score: 97.557 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0518842252 A G 0.01 0.02 0.02 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0518842252 NA 9.07E-19 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0518842252 NA 3.42E-66 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518842252 NA 2.48E-28 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518842252 NA 7.18E-78 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518842252 NA 4.70E-88 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518842252 NA 3.10E-90 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518842252 NA 5.73E-71 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518842252 NA 1.04E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518842252 NA 1.09E-57 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518842252 NA 2.10E-87 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518842252 NA 2.40E-29 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518842252 NA 1.72E-91 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518842252 NA 1.15E-68 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518842252 NA 2.33E-17 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518842252 NA 1.48E-106 mr1538_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518842252 NA 9.28E-38 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518842252 NA 3.15E-34 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251