Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0518114154:

Variant ID: vg0518114154 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 18114154
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


GATCGACTTCTATCTCCAACCTCCAACTATATAGCTAGCTAGCCTTTTGCTCTGAAAATAAAATGTGACCTGTTTAATTAACATCCTACTAGTTTGTCAA[C/A]
TTTAAAAGAGTTCAATAATTGGTTTTAGTTCGAGAAATATTTCCTCAAGACCAGCTAGGACAGAGAGAATATTTTTTTGCCCATACAAGGACGATGTGTA

Reverse complement sequence

TACACATCGTCCTTGTATGGGCAAAAAAATATTCTCTCTGTCCTAGCTGGTCTTGAGGAAATATTTCTCGAACTAAAACCAATTATTGAACTCTTTTAAA[G/T]
TTGACAAACTAGTAGGATGTTAATTAAACAGGTCACATTTTATTTTCAGAGCAAAAGGCTAGCTAGCTATATAGTTGGAGGTTGGAGATAGAAGTCGATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.70% 26.00% 0.32% 0.00% NA
All Indica  2759 90.80% 9.10% 0.18% 0.00% NA
All Japonica  1512 54.20% 45.20% 0.60% 0.00% NA
Aus  269 1.10% 98.50% 0.37% 0.00% NA
Indica I  595 96.60% 3.00% 0.34% 0.00% NA
Indica II  465 95.30% 4.50% 0.22% 0.00% NA
Indica III  913 89.80% 10.20% 0.00% 0.00% NA
Indica Intermediate  786 84.70% 15.00% 0.25% 0.00% NA
Temperate Japonica  767 25.40% 74.10% 0.52% 0.00% NA
Tropical Japonica  504 88.30% 11.30% 0.40% 0.00% NA
Japonica Intermediate  241 74.30% 24.50% 1.24% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0518114154 C -> A LOC_Os05g31140.1 upstream_gene_variant ; 3167.0bp to feature; MODIFIER silent_mutation Average:75.527; most accessible tissue: Zhenshan97 young leaf, score: 93.416 N N N N
vg0518114154 C -> A LOC_Os05g31140.3 upstream_gene_variant ; 3200.0bp to feature; MODIFIER silent_mutation Average:75.527; most accessible tissue: Zhenshan97 young leaf, score: 93.416 N N N N
vg0518114154 C -> A LOC_Os05g31140-LOC_Os05g31160 intergenic_region ; MODIFIER silent_mutation Average:75.527; most accessible tissue: Zhenshan97 young leaf, score: 93.416 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0518114154 C A -0.06 -0.01 0.0 -0.01 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0518114154 NA 2.33E-15 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0518114154 NA 3.10E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518114154 NA 1.17E-10 mr1229 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518114154 NA 4.51E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518114154 NA 6.79E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518114154 NA 5.67E-09 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518114154 NA 1.11E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251