Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517949741:

Variant ID: vg0517949741 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 17949741
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTGTTTGTAATGATCTAAAAACAAAAGCTGAAAAATAAACTACAATGAAAAAACTCCAAAATTAACTATAAATTTAAAATTGAAAATTTAAATTTTGAC[T/C]
GATAAGTATAAGTATAAGAAAAAGATAGGACCGTTTATCACCTGTGGCCATCTTTTATAGTTTAGTGTAAGCGATTTCTCTTTCACATGCTACACAAAAA

Reverse complement sequence

TTTTTGTGTAGCATGTGAAAGAGAAATCGCTTACACTAAACTATAAAAGATGGCCACAGGTGATAAACGGTCCTATCTTTTTCTTATACTTATACTTATC[A/G]
GTCAAAATTTAAATTTTCAATTTTAAATTTATAGTTAATTTTGGAGTTTTTTCATTGTAGTTTATTTTTCAGCTTTTGTTTTTAGATCATTACAAACACA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.10%	6.90%	0.02%	0.00%	NA
All Indica	2759	99.80%	0.20%	0.04%	0.00%	NA
All Japonica	1512	84.90%	15.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.70%	0.20%	0.11%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	85.80%	14.20%	0.00%	0.00%	NA
Tropical Japonica	504	83.70%	16.30%	0.00%	0.00%	NA
Japonica Intermediate	241	84.20%	15.80%	0.00%	0.00%	NA
VI/Aromatic	96	13.50%	86.50%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0517949741	T -> C	LOC_Os05g30900.1	upstream_gene_variant ; 4074.0bp to feature; MODIFIER	silent_mutation	Average:25.986; most accessible tissue: Callus, score: 56.723	N	N	N	N
vg0517949741	T -> C	LOC_Os05g30920.1	upstream_gene_variant ; 1558.0bp to feature; MODIFIER	silent_mutation	Average:25.986; most accessible tissue: Callus, score: 56.723	N	N	N	N
vg0517949741	T -> C	LOC_Os05g30920.2	upstream_gene_variant ; 1558.0bp to feature; MODIFIER	silent_mutation	Average:25.986; most accessible tissue: Callus, score: 56.723	N	N	N	N
vg0517949741	T -> C	LOC_Os05g30920.3	upstream_gene_variant ; 1558.0bp to feature; MODIFIER	silent_mutation	Average:25.986; most accessible tissue: Callus, score: 56.723	N	N	N	N
vg0517949741	T -> C	LOC_Os05g30900-LOC_Os05g30920	intergenic_region ; MODIFIER	silent_mutation	Average:25.986; most accessible tissue: Callus, score: 56.723	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0517949741	5.62E-06	NA	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0517949741	NA	1.08E-09	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517949741	NA	1.79E-08	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517949741	3.93E-07	3.93E-07	mr1608_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517949741	NA	8.03E-06	mr1736_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517949741	NA	5.76E-11	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517949741	5.94E-06	NA	mr1838_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517949741	NA	4.17E-06	mr1838_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517949741	NA	1.54E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517949741	NA	3.05E-19	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251