\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517947097:

Variant ID: vg0517947097 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17947097
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCCACATGTATGTGGGTCCCACAATTTCTTTTATGTGTCGATGACAAATGGGTCCCACATATATTTTTTAATCTAAAGGCCACCTAAACGCCACGTCAA[C/T]
GCCACGTATAAAGGAGACCCGGTCAATACCGCCACGTAGGCGCCACGTCAGCAAAACCGCCCTCCAAAACCACCTAGGGAGTCAAATTGCACCGGTTTTA

Reverse complement sequence

TAAAACCGGTGCAATTTGACTCCCTAGGTGGTTTTGGAGGGCGGTTTTGCTGACGTGGCGCCTACGTGGCGGTATTGACCGGGTCTCCTTTATACGTGGC[G/A]
TTGACGTGGCGTTTAGGTGGCCTTTAGATTAAAAAATATATGTGGGACCCATTTGTCATCGACACATAAAAGAAATTGTGGGACCCACATACATGTGGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.00% 7.00% 0.02% 0.00% NA
All Indica  2759 99.80% 0.20% 0.04% 0.00% NA
All Japonica  1512 84.80% 15.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.70% 0.20% 0.11% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 85.70% 14.30% 0.00% 0.00% NA
Tropical Japonica  504 83.70% 16.30% 0.00% 0.00% NA
Japonica Intermediate  241 84.20% 15.80% 0.00% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517947097 C -> T LOC_Os05g30900.1 upstream_gene_variant ; 1430.0bp to feature; MODIFIER silent_mutation Average:66.15; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0517947097 C -> T LOC_Os05g30920.1 upstream_gene_variant ; 4202.0bp to feature; MODIFIER silent_mutation Average:66.15; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0517947097 C -> T LOC_Os05g30920.2 upstream_gene_variant ; 4202.0bp to feature; MODIFIER silent_mutation Average:66.15; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0517947097 C -> T LOC_Os05g30920.3 upstream_gene_variant ; 4202.0bp to feature; MODIFIER silent_mutation Average:66.15; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0517947097 C -> T LOC_Os05g30900-LOC_Os05g30920 intergenic_region ; MODIFIER silent_mutation Average:66.15; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0517947097 C T -0.01 -0.02 -0.02 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517947097 2.10E-07 NA Grain_length All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0517947097 3.06E-07 NA Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0517947097 NA 1.23E-10 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517947097 NA 1.92E-08 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517947097 4.26E-06 4.26E-06 mr1608_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517947097 NA 3.13E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517947097 NA 6.17E-11 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517947097 NA 2.44E-06 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517947097 5.48E-06 NA mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517947097 NA 5.99E-06 mr1838_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517947097 NA 5.93E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517947097 NA 9.31E-20 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251