\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507101071:

Variant ID: vg0507101071 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7101071
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, T: 0.14, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAACTTAAATCGAAAGTTTTCAAATCTAACTTCAAAAATTTTCAATCTGTTAGTAAAAATATCTCAAAAAAATCTTTAAAATCTTTCCTAATTACTAT[C/T]
ATTAGTGTTAAATATATTAACTAATATAGTTAGTTAAGACTAAGTGAGGGGAGGAGTACTCGCTGCTGGCGCGCACGCGCCAGCTTGCAGCCTCCGATAA

Reverse complement sequence

TTATCGGAGGCTGCAAGCTGGCGCGTGCGCGCCAGCAGCGAGTACTCCTCCCCTCACTTAGTCTTAACTAACTATATTAGTTAATATATTTAACACTAAT[G/A]
ATAGTAATTAGGAAAGATTTTAAAGATTTTTTTGAGATATTTTTACTAACAGATTGAAAATTTTTGAAGTTAGATTTGAAAACTTTCGATTTAAGTTTCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.30% 22.50% 0.13% 38.13% NA
All Indica  2759 55.60% 6.80% 0.14% 37.48% NA
All Japonica  1512 4.70% 56.50% 0.07% 38.69% NA
Aus  269 80.30% 0.00% 0.37% 19.33% NA
Indica I  595 71.80% 12.30% 0.00% 15.97% NA
Indica II  465 26.20% 2.80% 0.22% 70.75% NA
Indica III  913 54.50% 5.70% 0.11% 39.65% NA
Indica Intermediate  786 62.00% 6.20% 0.25% 31.55% NA
Temperate Japonica  767 0.70% 91.10% 0.00% 8.21% NA
Tropical Japonica  504 6.00% 9.30% 0.20% 84.52% NA
Japonica Intermediate  241 14.90% 45.20% 0.00% 39.83% NA
VI/Aromatic  96 4.20% 2.10% 0.00% 93.75% NA
Intermediate  90 33.30% 21.10% 0.00% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507101071 C -> T LOC_Os05g12350.1 upstream_gene_variant ; 1665.0bp to feature; MODIFIER silent_mutation Average:73.044; most accessible tissue: Minghui63 panicle, score: 95.083 N N N N
vg0507101071 C -> T LOC_Os05g12350-LOC_Os05g12360 intergenic_region ; MODIFIER silent_mutation Average:73.044; most accessible tissue: Minghui63 panicle, score: 95.083 N N N N
vg0507101071 C -> DEL N N silent_mutation Average:73.044; most accessible tissue: Minghui63 panicle, score: 95.083 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0507101071 C T 0.02 0.03 0.03 0.04 0.05 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507101071 NA 2.82E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507101071 3.45E-07 NA Heading_date All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507101071 NA 1.84E-08 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507101071 1.15E-06 7.34E-21 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507101071 NA 2.20E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507101071 NA 3.08E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507101071 1.24E-07 1.62E-28 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251