\
| Variant ID: vg0506631795 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6631795 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 241. )
AAATGGCCGGATCGATCAAAGTTCTGGTACTATGCTCACGGTGGAACGCTTAACCCAGTTGATGGCTCCCTTGTCTTCGGCGATCAGATACGCGAGGCTG[C/T]
CAGTCGACTAACGGACGCAGTGGTAGCCTCTTCTTAGGGCACATTCCGACCCGACAGAGAGAAGGATGAGCTGTCACTCGCCCTTCAGACTCCAAAGCAT
ATGCTTTGGAGTCTGAAGGGCGAGTGACAGCTCATCCTTCTCTCTGTCGGGTCGGAATGTGCCCTAAGAAGAGGCTACCACTGCGTCCGTTAGTCGACTG[G/A]
CAGCCTCGCGTATCTGATCGCCGAAGACAAGGGAGCCATCAACTGGGTTAAGCGTTCCACCGTGAGCATAGTACCAGAACTTTGATCGATCCGGCCATTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.60% | 34.20% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 61.30% | 38.40% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 65.30% | 34.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 57.00% | 42.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 38.20% | 61.20% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 69.50% | 30.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 24.60% | 75.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 58.10% | 41.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 28.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506631795 | C -> T | LOC_Os05g11680-LOC_Os05g11700 | intergenic_region ; MODIFIER | silent_mutation | Average:57.757; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506631795 | NA | 7.33E-14 | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0506631795 | 2.16E-08 | NA | mr1039 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631795 | 4.65E-07 | 1.33E-14 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631795 | NA | 1.44E-06 | mr1050 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631795 | NA | 2.84E-07 | mr1272 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631795 | NA | 5.80E-06 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631795 | NA | 3.59E-09 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631795 | NA | 1.30E-06 | mr1887 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631795 | 1.18E-08 | NA | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631795 | 5.73E-08 | 8.69E-18 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631795 | NA | 1.35E-08 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631795 | NA | 8.19E-06 | mr1383_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631795 | NA | 2.92E-06 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631795 | NA | 1.40E-06 | mr1629_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631795 | 5.81E-06 | NA | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631795 | 7.02E-07 | 1.19E-15 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631795 | NA | 2.29E-14 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |