\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506604004:

Variant ID: vg0506604004 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6604004
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTCGGTGCGTGGGACGCTGCCTCTCCCGTTTGCAGCGGCCCGCCCCGATGGCGATGACGACGGCGCATGGGACGTTGCCTCCCCCGTCCGTAACGGCG[A/G]
TGGAACTGGTCCCCCTGCCCGCGCCGTCGCCATCACTGCCAGTGACTGACTTCGAGGAGTTCTCCCCGGTGAGCAAGGGCATTTTTGTCTCATCACTACG

Reverse complement sequence

CGTAGTGATGAGACAAAAATGCCCTTGCTCACCGGGGAGAACTCCTCGAAGTCAGTCACTGGCAGTGATGGCGACGGCGCGGGCAGGGGGACCAGTTCCA[T/C]
CGCCGTTACGGACGGGGGAGGCAACGTCCCATGCGCCGTCGTCATCGCCATCGGGGCGGGCCGCTGCAAACGGGAGAGGCAGCGTCCCACGCACCGAGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.70% 12.70% 1.65% 0.00% NA
All Indica  2759 97.00% 2.10% 0.87% 0.00% NA
All Japonica  1512 61.80% 34.90% 3.24% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 91.40% 6.90% 1.68% 0.00% NA
Indica II  465 98.30% 1.10% 0.65% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 97.20% 1.40% 1.40% 0.00% NA
Temperate Japonica  767 31.00% 63.20% 5.74% 0.00% NA
Tropical Japonica  504 98.60% 1.20% 0.20% 0.00% NA
Japonica Intermediate  241 83.00% 15.40% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 80.00% 14.40% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506604004 A -> G LOC_Os05g11640.1 missense_variant ; p.Met18Val; MODERATE nonsynonymous_codon ; M18V Average:77.913; most accessible tissue: Zhenshan97 panicle, score: 85.665 unknown unknown TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0506604004 A G -0.01 0.0 0.0 -0.02 -0.05 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506604004 NA 2.07E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0506604004 NA 5.51E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0506604004 NA 6.08E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506604004 NA 3.52E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506604004 NA 1.10E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506604004 NA 1.12E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506604004 NA 3.12E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506604004 NA 1.73E-06 mr1051_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506604004 NA 8.73E-13 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506604004 NA 3.37E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506604004 NA 1.12E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506604004 NA 1.23E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506604004 NA 1.50E-06 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251