\
| Variant ID: vg0505373379 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5373379 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.22, others allele: 0.00, population size: 100. )
AGCGCACGTCTCAAATTGTTTAACAGAGTGTTTTTTTTAAAAAAAAAACAACCTTGTATATGATAGTAGAAGTTTCTTTTCTAAAAAATCAATTAAACTT[G/A]
TTTTTCAAGTTTATAGTAATTAATATTATAATTAATTATGTGCTAATGATTTGTCTTGTTTTACATGTCACCAGGCCCGGCCCTGAGGAGGTCGAGCTGT
ACAGCTCGACCTCCTCAGGGCCGGGCCTGGTGACATGTAAAACAAGACAAATCATTAGCACATAATTAATTATAATATTAATTACTATAAACTTGAAAAA[C/T]
AAGTTTAATTGATTTTTTAGAAAAGAAACTTCTACTATCATATACAAGGTTGTTTTTTTTTTAAAAAAAACACTCTGTTAAACAATTTGAGACGTGCGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.60% | 43.30% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 49.00% | 50.90% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 73.90% | 26.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 22.70% | 77.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 85.20% | 14.60% | 0.17% | 0.00% | NA |
| Indica II | 465 | 22.40% | 77.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 39.80% | 60.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 48.20% | 51.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 44.40% | 55.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.40% | 28.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 8.30% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 37.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505373379 | G -> A | LOC_Os05g09520-LOC_Os05g09530 | intergenic_region ; MODIFIER | silent_mutation | Average:48.259; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505373379 | 5.56E-06 | 2.59E-22 | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505373379 | NA | 2.03E-16 | Grain_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505373379 | 4.08E-12 | NA | Grain_thickness | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505373379 | 1.04E-07 | 5.70E-14 | Grain_thickness | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505373379 | 2.18E-06 | 5.96E-15 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505373379 | 1.88E-25 | NA | Grain_width | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505373379 | 9.65E-19 | 4.86E-34 | Grain_width | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505373379 | 2.42E-10 | 6.42E-18 | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505373379 | NA | 3.26E-08 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505373379 | NA | 7.21E-08 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505373379 | NA | 2.32E-07 | mr1733 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505373379 | NA | 7.84E-13 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505373379 | NA | 6.35E-08 | mr1183_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505373379 | NA | 6.18E-07 | mr1319_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505373379 | NA | 4.86E-07 | mr1330_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505373379 | NA | 1.35E-09 | mr1771_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505373379 | NA | 6.48E-06 | mr1838_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505373379 | NA | 9.10E-06 | mr1959_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |