\
| Variant ID: vg0505372955 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5372955 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.64, G: 0.37, others allele: 0.00, population size: 109. )
TTGGCAGATGCCAGGAAAGAAAAGAAAAGTCAATCCATGACTCAAATCTGGCTTTAAATTTCTTCTCCAAAAAGAATCAAAAGGCTGAATTTCCTGAAAA[A/G]
TCTTAAATCACACCGTAAAGTCTTAAAAAACAGAGGACGAAGATAACATCATGCAAAATCGTGATGCTGGTGCTATGTTGTCAATATCACACACTTTCAT
ATGAAAGTGTGTGATATTGACAACATAGCACCAGCATCACGATTTTGCATGATGTTATCTTCGTCCTCTGTTTTTTAAGACTTTACGGTGTGATTTAAGA[T/C]
TTTTCAGGAAATTCAGCCTTTTGATTCTTTTTGGAGAAGAAATTTAAAGCCAGATTTGAGTCATGGATTGACTTTTCTTTTCTTTCCTGGCATCTGCCAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.40% | 43.40% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 49.10% | 50.70% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 73.30% | 26.30% | 0.40% | 0.00% | NA |
| Aus | 269 | 22.70% | 77.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 85.20% | 14.60% | 0.17% | 0.00% | NA |
| Indica II | 465 | 22.80% | 76.80% | 0.43% | 0.00% | NA |
| Indica III | 913 | 40.00% | 60.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 48.10% | 51.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 92.70% | 6.50% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 44.80% | 55.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.00% | 29.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 8.30% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 41.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505372955 | A -> G | LOC_Os05g09520-LOC_Os05g09530 | intergenic_region ; MODIFIER | silent_mutation | Average:41.504; most accessible tissue: Callus, score: 62.83 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505372955 | NA | 5.73E-21 | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505372955 | NA | 1.47E-15 | Grain_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505372955 | 5.34E-13 | NA | Grain_thickness | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505372955 | 6.65E-08 | 1.71E-14 | Grain_thickness | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505372955 | 2.18E-06 | 5.96E-15 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505372955 | 2.20E-23 | NA | Grain_width | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505372955 | 5.96E-18 | 1.14E-33 | Grain_width | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505372955 | 2.42E-10 | 6.42E-18 | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505372955 | NA | 5.85E-08 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505372955 | NA | 1.30E-07 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505372955 | NA | 2.78E-08 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505372955 | NA | 2.32E-07 | mr1733 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505372955 | NA | 7.84E-13 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505372955 | NA | 1.18E-07 | mr1183_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505372955 | NA | 1.19E-06 | mr1319_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505372955 | NA | 1.36E-06 | mr1330_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505372955 | NA | 1.35E-09 | mr1771_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505372955 | NA | 9.46E-06 | mr1959_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |