\
| Variant ID: vg0505358972 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5358972 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 254. )
ATTTTGTAGGTGATAACTTTTTCATTTGAAATCTTTTAGATATTCAAATCTATGATTCAAATCTCAGTTAGGTAGGCTCAAATGGAACGATATGCATTTT[C/T]
CAACAGAATTGATGCATAGGTGAGTTGGTAAAAGAGAGCACGTGTGAAGGATAGGTCTTAAGTTCGAATCCTAGCCAAGACACGATATCAAAAAAAATAA
TTATTTTTTTTGATATCGTGTCTTGGCTAGGATTCGAACTTAAGACCTATCCTTCACACGTGCTCTCTTTTACCAACTCACCTATGCATCAATTCTGTTG[G/A]
AAAATGCATATCGTTCCATTTGAGCCTACCTAACTGAGATTTGAATCATAGATTTGAATATCTAAAAGATTTCAAATGAAAAAGTTATCACCTACAAAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.60% | 32.50% | 0.17% | 1.76% | NA |
| All Indica | 2759 | 53.80% | 46.00% | 0.11% | 0.07% | NA |
| All Japonica | 1512 | 84.60% | 9.80% | 0.26% | 5.36% | NA |
| Aus | 269 | 77.70% | 22.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 17.10% | 82.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 86.20% | 13.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 59.80% | 40.00% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 55.50% | 44.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 91.90% | 7.80% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 71.80% | 13.30% | 0.60% | 14.29% | NA |
| Japonica Intermediate | 241 | 88.00% | 8.70% | 0.41% | 2.90% | NA |
| VI/Aromatic | 96 | 60.40% | 39.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 23.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505358972 | C -> T | LOC_Os05g09510-LOC_Os05g09520 | intergenic_region ; MODIFIER | silent_mutation | Average:26.111; most accessible tissue: Callus, score: 41.682 | N | N | N | N |
| vg0505358972 | C -> DEL | N | N | silent_mutation | Average:26.111; most accessible tissue: Callus, score: 41.682 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505358972 | 4.40E-06 | NA | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505358972 | 2.86E-08 | 1.88E-28 | Grain_length | Ind_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505358972 | 6.50E-09 | 2.11E-16 | Grain_thickness | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505358972 | 1.23E-09 | NA | Grain_width | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505358972 | 1.56E-24 | 5.25E-49 | Grain_width | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505358972 | NA | 4.20E-08 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505358972 | NA | 9.94E-06 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505358972 | NA | 5.99E-08 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505358972 | NA | 1.42E-07 | mr1183_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505358972 | NA | 3.61E-06 | mr1319_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505358972 | NA | 4.22E-08 | mr1330_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505358972 | NA | 4.56E-06 | mr1838_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |