\
| Variant ID: vg0505358756 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5358756 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 117. )
TACGCTTGTTTGTTTGTAGAGGGGAGCTTCCAGATGTGATTTTTACTGCCAAATAGATCTAACGATCTAAAATAATGGGTCCACCAATTTAAATGAAAAT[C/T]
AATGGTCGGATTTATTTTTTTTTATTAGAATGCCACTTGGCGACTCGATAGCGTTTATAGGAAGTTTAATGGACTTTTAGTATATAATAGATTATAGCTC
GAGCTATAATCTATTATATACTAAAAGTCCATTAAACTTCCTATAAACGCTATCGAGTCGCCAAGTGGCATTCTAATAAAAAAAAATAAATCCGACCATT[G/A]
ATTTTCATTTAAATTGGTGGACCCATTATTTTAGATCGTTAGATCTATTTGGCAGTAAAAATCACATCTGGAAGCTCCCCTCTACAAACAAACAAGCGTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.90% | 31.00% | 0.42% | 1.71% | NA |
| All Indica | 2759 | 53.90% | 45.90% | 0.22% | 0.04% | NA |
| All Japonica | 1512 | 88.70% | 5.30% | 0.73% | 5.29% | NA |
| Aus | 269 | 76.20% | 22.70% | 1.12% | 0.00% | NA |
| Indica I | 595 | 17.80% | 81.50% | 0.67% | 0.00% | NA |
| Indica II | 465 | 85.20% | 14.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 59.80% | 40.00% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 55.70% | 44.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 97.10% | 1.80% | 0.78% | 0.26% | NA |
| Tropical Japonica | 504 | 73.20% | 11.90% | 0.79% | 14.09% | NA |
| Japonica Intermediate | 241 | 94.20% | 2.50% | 0.41% | 2.90% | NA |
| VI/Aromatic | 96 | 60.40% | 39.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505358756 | C -> T | LOC_Os05g09510-LOC_Os05g09520 | intergenic_region ; MODIFIER | silent_mutation | Average:22.13; most accessible tissue: Callus, score: 36.907 | N | N | N | N |
| vg0505358756 | C -> DEL | N | N | silent_mutation | Average:22.13; most accessible tissue: Callus, score: 36.907 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505358756 | 7.73E-08 | NA | Grain_length | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505358756 | 1.23E-06 | 4.42E-26 | Grain_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505358756 | 3.93E-06 | NA | Grain_thickness | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505358756 | 2.45E-09 | 4.31E-17 | Grain_thickness | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505358756 | 2.99E-13 | NA | Grain_width | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505358756 | 8.92E-22 | 6.57E-46 | Grain_width | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505358756 | NA | 3.95E-08 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505358756 | NA | 4.03E-08 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505358756 | NA | 1.73E-07 | mr1183_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505358756 | NA | 5.18E-06 | mr1319_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505358756 | NA | 1.20E-07 | mr1330_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |