\
| Variant ID: vg0503613659 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 3613659 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGCAAAAAAAAAAGTTTCTATACGAAAGTTGCTTAAAAAAATCATATTGATCTATTTTTGAAAAAAAATAGCCAATACTTAATTAATCACGTGCTAATA[A/G]
ACCGCTCCGTTTTTCGTGCGCACTGATCTGGTTGGGAACGCTGGCTTCCGAACACAGCTATGTTCGCCATTACCAGTTCCCAACCGGAATAGTACGCACA
TGTGCGTACTATTCCGGTTGGGAACTGGTAATGGCGAACATAGCTGTGTTCGGAAGCCAGCGTTCCCAACCAGATCAGTGCGCACGAAAAACGGAGCGGT[T/C]
TATTAGCACGTGATTAATTAAGTATTGGCTATTTTTTTTCAAAAATAGATCAATATGATTTTTTTAAGCAACTTTCGTATAGAAACTTTTTTTTTTGCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.20% | 10.60% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 68.20% | 31.40% | 0.40% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 46.70% | 52.90% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 93.50% | 6.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 83.80% | 15.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 15.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0503613659 | A -> G | LOC_Os05g06900.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:64.093; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg0503613659 | A -> G | LOC_Os05g06910.1 | upstream_gene_variant ; 978.0bp to feature; MODIFIER | silent_mutation | Average:64.093; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg0503613659 | A -> G | LOC_Os05g06890.1 | downstream_gene_variant ; 2288.0bp to feature; MODIFIER | silent_mutation | Average:64.093; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0503613659 | NA | 6.19E-13 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0503613659 | 7.69E-08 | 2.22E-16 | Heading_date | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0503613659 | NA | 3.32E-13 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0503613659 | NA | 2.11E-12 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0503613659 | NA | 6.83E-18 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0503613659 | NA | 2.14E-12 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0503613659 | NA | 1.14E-06 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503613659 | NA | 2.40E-06 | mr1359_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503613659 | NA | 1.75E-09 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503613659 | NA | 3.63E-08 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |