\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501827640:

Variant ID: vg0501827640 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1827640
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.13, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


TGCCTCCATTCTTTGAACTAAGGGTTGAATTTATTTTGAGACTGGGAGAATATCATATGCCCTTGCATGTTTCATACCCCCTCCGTCTCATAATATAAAG[A/G,T]
ATTTGGGTTGGATGTGACACATCATATTACTACGAATTTGAACAAATGGACAGGAACAAAACTAGCATCAAAACAAGGGGGTGCACTACCATTGAACATT

Reverse complement sequence

AATGTTCAATGGTAGTGCACCCCCTTGTTTTGATGCTAGTTTTGTTCCTGTCCATTTGTTCAAATTCGTAGTAATATGATGTGTCACATCCAACCCAAAT[T/C,A]
CTTTATATTATGAGACGGAGGGGGTATGAAACATGCAAGGGCATATGATATTCTCCCAGTCTCAAAATAAATTCAACCCTTAGTTCAAAGAATGGAGGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.10% 16.70% 1.16% 42.93% T: 0.08%
All Indica  2759 35.90% 1.40% 1.27% 61.29% T: 0.07%
All Japonica  1512 47.80% 47.80% 1.26% 3.24% NA
Aus  269 4.10% 0.00% 0.00% 95.91% NA
Indica I  595 1.50% 1.80% 0.50% 96.13% NA
Indica II  465 29.90% 3.20% 0.86% 66.02% NA
Indica III  913 64.50% 0.20% 3.07% 32.20% NA
Indica Intermediate  786 32.30% 1.50% 0.00% 65.90% T: 0.25%
Temperate Japonica  767 25.70% 72.90% 0.00% 1.43% NA
Tropical Japonica  504 71.80% 22.00% 1.19% 4.96% NA
Japonica Intermediate  241 67.60% 21.60% 5.39% 5.39% NA
VI/Aromatic  96 86.50% 3.10% 0.00% 10.42% NA
Intermediate  90 47.80% 25.60% 1.11% 23.33% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501827640 A -> T LOC_Os05g04040.1 upstream_gene_variant ; 3652.0bp to feature; MODIFIER silent_mutation Average:27.325; most accessible tissue: Callus, score: 57.977 N N N N
vg0501827640 A -> T LOC_Os05g04050.1 downstream_gene_variant ; 997.0bp to feature; MODIFIER silent_mutation Average:27.325; most accessible tissue: Callus, score: 57.977 N N N N
vg0501827640 A -> T LOC_Os05g04060.1 downstream_gene_variant ; 627.0bp to feature; MODIFIER silent_mutation Average:27.325; most accessible tissue: Callus, score: 57.977 N N N N
vg0501827640 A -> T LOC_Os05g04070.1 downstream_gene_variant ; 3099.0bp to feature; MODIFIER silent_mutation Average:27.325; most accessible tissue: Callus, score: 57.977 N N N N
vg0501827640 A -> T LOC_Os05g04050-LOC_Os05g04060 intergenic_region ; MODIFIER silent_mutation Average:27.325; most accessible tissue: Callus, score: 57.977 N N N N
vg0501827640 A -> G LOC_Os05g04040.1 upstream_gene_variant ; 3652.0bp to feature; MODIFIER silent_mutation Average:27.325; most accessible tissue: Callus, score: 57.977 N N N N
vg0501827640 A -> G LOC_Os05g04050.1 downstream_gene_variant ; 997.0bp to feature; MODIFIER silent_mutation Average:27.325; most accessible tissue: Callus, score: 57.977 N N N N
vg0501827640 A -> G LOC_Os05g04060.1 downstream_gene_variant ; 627.0bp to feature; MODIFIER silent_mutation Average:27.325; most accessible tissue: Callus, score: 57.977 N N N N
vg0501827640 A -> G LOC_Os05g04070.1 downstream_gene_variant ; 3099.0bp to feature; MODIFIER silent_mutation Average:27.325; most accessible tissue: Callus, score: 57.977 N N N N
vg0501827640 A -> G LOC_Os05g04050-LOC_Os05g04060 intergenic_region ; MODIFIER silent_mutation Average:27.325; most accessible tissue: Callus, score: 57.977 N N N N
vg0501827640 A -> DEL N N silent_mutation Average:27.325; most accessible tissue: Callus, score: 57.977 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501827640 NA 9.20E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0501827640 NA 2.89E-08 mr1192 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501827640 NA 9.32E-06 mr1318 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501827640 NA 5.28E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501827640 NA 3.57E-07 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501827640 NA 1.64E-06 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501827640 NA 2.14E-06 mr1527_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501827640 2.00E-06 2.00E-06 mr1891_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501827640 NA 1.33E-06 mr1952_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251