\
| Variant ID: vg0501827640 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 1827640 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.13, others allele: 0.00, population size: 72. )
TGCCTCCATTCTTTGAACTAAGGGTTGAATTTATTTTGAGACTGGGAGAATATCATATGCCCTTGCATGTTTCATACCCCCTCCGTCTCATAATATAAAG[A/G,T]
ATTTGGGTTGGATGTGACACATCATATTACTACGAATTTGAACAAATGGACAGGAACAAAACTAGCATCAAAACAAGGGGGTGCACTACCATTGAACATT
AATGTTCAATGGTAGTGCACCCCCTTGTTTTGATGCTAGTTTTGTTCCTGTCCATTTGTTCAAATTCGTAGTAATATGATGTGTCACATCCAACCCAAAT[T/C,A]
CTTTATATTATGAGACGGAGGGGGTATGAAACATGCAAGGGCATATGATATTCTCCCAGTCTCAAAATAAATTCAACCCTTAGTTCAAAGAATGGAGGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.10% | 16.70% | 1.16% | 42.93% | T: 0.08% |
| All Indica | 2759 | 35.90% | 1.40% | 1.27% | 61.29% | T: 0.07% |
| All Japonica | 1512 | 47.80% | 47.80% | 1.26% | 3.24% | NA |
| Aus | 269 | 4.10% | 0.00% | 0.00% | 95.91% | NA |
| Indica I | 595 | 1.50% | 1.80% | 0.50% | 96.13% | NA |
| Indica II | 465 | 29.90% | 3.20% | 0.86% | 66.02% | NA |
| Indica III | 913 | 64.50% | 0.20% | 3.07% | 32.20% | NA |
| Indica Intermediate | 786 | 32.30% | 1.50% | 0.00% | 65.90% | T: 0.25% |
| Temperate Japonica | 767 | 25.70% | 72.90% | 0.00% | 1.43% | NA |
| Tropical Japonica | 504 | 71.80% | 22.00% | 1.19% | 4.96% | NA |
| Japonica Intermediate | 241 | 67.60% | 21.60% | 5.39% | 5.39% | NA |
| VI/Aromatic | 96 | 86.50% | 3.10% | 0.00% | 10.42% | NA |
| Intermediate | 90 | 47.80% | 25.60% | 1.11% | 23.33% | T: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0501827640 | A -> T | LOC_Os05g04040.1 | upstream_gene_variant ; 3652.0bp to feature; MODIFIER | silent_mutation | Average:27.325; most accessible tissue: Callus, score: 57.977 | N | N | N | N |
| vg0501827640 | A -> T | LOC_Os05g04050.1 | downstream_gene_variant ; 997.0bp to feature; MODIFIER | silent_mutation | Average:27.325; most accessible tissue: Callus, score: 57.977 | N | N | N | N |
| vg0501827640 | A -> T | LOC_Os05g04060.1 | downstream_gene_variant ; 627.0bp to feature; MODIFIER | silent_mutation | Average:27.325; most accessible tissue: Callus, score: 57.977 | N | N | N | N |
| vg0501827640 | A -> T | LOC_Os05g04070.1 | downstream_gene_variant ; 3099.0bp to feature; MODIFIER | silent_mutation | Average:27.325; most accessible tissue: Callus, score: 57.977 | N | N | N | N |
| vg0501827640 | A -> T | LOC_Os05g04050-LOC_Os05g04060 | intergenic_region ; MODIFIER | silent_mutation | Average:27.325; most accessible tissue: Callus, score: 57.977 | N | N | N | N |
| vg0501827640 | A -> G | LOC_Os05g04040.1 | upstream_gene_variant ; 3652.0bp to feature; MODIFIER | silent_mutation | Average:27.325; most accessible tissue: Callus, score: 57.977 | N | N | N | N |
| vg0501827640 | A -> G | LOC_Os05g04050.1 | downstream_gene_variant ; 997.0bp to feature; MODIFIER | silent_mutation | Average:27.325; most accessible tissue: Callus, score: 57.977 | N | N | N | N |
| vg0501827640 | A -> G | LOC_Os05g04060.1 | downstream_gene_variant ; 627.0bp to feature; MODIFIER | silent_mutation | Average:27.325; most accessible tissue: Callus, score: 57.977 | N | N | N | N |
| vg0501827640 | A -> G | LOC_Os05g04070.1 | downstream_gene_variant ; 3099.0bp to feature; MODIFIER | silent_mutation | Average:27.325; most accessible tissue: Callus, score: 57.977 | N | N | N | N |
| vg0501827640 | A -> G | LOC_Os05g04050-LOC_Os05g04060 | intergenic_region ; MODIFIER | silent_mutation | Average:27.325; most accessible tissue: Callus, score: 57.977 | N | N | N | N |
| vg0501827640 | A -> DEL | N | N | silent_mutation | Average:27.325; most accessible tissue: Callus, score: 57.977 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0501827640 | NA | 9.20E-10 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0501827640 | NA | 2.89E-08 | mr1192 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501827640 | NA | 9.32E-06 | mr1318 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501827640 | NA | 5.28E-07 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501827640 | NA | 3.57E-07 | mr1729 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501827640 | NA | 1.64E-06 | mr1807 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501827640 | NA | 2.14E-06 | mr1527_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501827640 | 2.00E-06 | 2.00E-06 | mr1891_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501827640 | NA | 1.33E-06 | mr1952_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |