Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500558142:

Variant ID: vg0500558142 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 558142
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, G: 0.10, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

CCCATTCACATGCACTTAGATGTTGCACTATTACAACCTATTATGCATGAAAGAACAAGGGATAGACACATTGGTTTTAGAAAACAACAGTTTCACTACT[A/G]
GAGTAGTTTTCTATTACACATTTACACTTTGTTCTGAAATAAAACAAGAAGACTTTTAGTATGGTCCTTAGGGAGGAACCTTGAACTTTCAAATAGTACA

Reverse complement sequence

TGTACTATTTGAAAGTTCAAGGTTCCTCCCTAAGGACCATACTAAAAGTCTTCTTGTTTTATTTCAGAACAAAGTGTAAATGTGTAATAGAAAACTACTC[T/C]
AGTAGTGAAACTGTTGTTTTCTAAAACCAATGTGTCTATCCCTTGTTCTTTCATGCATAATAGGTTGTAATAGTGCAACATCTAAGTGCATGTGAATGGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.80%	38.20%	0.00%	0.00%	NA
All Indica	2759	94.00%	6.00%	0.00%	0.00%	NA
All Japonica	1512	4.20%	95.80%	0.00%	0.00%	NA
Aus	269	74.30%	25.70%	0.00%	0.00%	NA
Indica I	595	98.00%	2.00%	0.00%	0.00%	NA
Indica II	465	92.30%	7.70%	0.00%	0.00%	NA
Indica III	913	91.20%	8.80%	0.00%	0.00%	NA
Indica Intermediate	786	95.20%	4.80%	0.00%	0.00%	NA
Temperate Japonica	767	7.20%	92.80%	0.00%	0.00%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	2.90%	97.10%	0.00%	0.00%	NA
VI/Aromatic	96	30.20%	69.80%	0.00%	0.00%	NA
Intermediate	90	41.10%	58.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0500558142	A -> G	LOC_Os05g01990.1	upstream_gene_variant ; 4734.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500558142	A -> G	LOC_Os05g01990.2	upstream_gene_variant ; 4734.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500558142	A -> G	LOC_Os05g01970.5	downstream_gene_variant ; 3800.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500558142	A -> G	LOC_Os05g01970.1	intron_variant ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500558142	A -> G	LOC_Os05g01970.2	intron_variant ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500558142	A -> G	LOC_Os05g01970.3	intron_variant ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500558142	A -> G	LOC_Os05g01970.4	intron_variant ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0500558142	NA	1.70E-20	Yield	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0500558142	NA	6.65E-15	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	7.16E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	8.11E-09	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	2.60E-10	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	1.48E-06	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	1.88E-10	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	1.85E-16	mr1323	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	4.98E-11	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	1.66E-12	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	9.74E-06	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	1.35E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	1.62E-06	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	4.64E-08	mr1527	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	9.98E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	1.12E-07	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	2.74E-11	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	2.78E-19	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	1.07E-10	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	1.53E-09	mr1776	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	2.99E-07	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	3.35E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	2.92E-09	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	9.87E-06	mr1768_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500558142	NA	2.58E-06	mr1970_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251