\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431894926:

Variant ID: vg0431894926 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31894926
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.68, A: 0.32, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGGCAATGCCAAAAATTTGGTATAGTTGCTAAAATTTTGGCATGATTTCTTATATAGTTACAAAAATTTGGCAGCAAACTAAATGTAGCCACTTTTTT[G/A]
ACAATTTTATCAAAACTTGGTAATATTGAAAATGTCATCAAAGTGAAGAGGCCTAAAAATATACTATTCAAAGTGCCAAACAATTTGATAGCACATATTT

Reverse complement sequence

AAATATGTGCTATCAAATTGTTTGGCACTTTGAATAGTATATTTTTAGGCCTCTTCACTTTGATGACATTTTCAATATTACCAAGTTTTGATAAAATTGT[C/T]
AAAAAAGTGGCTACATTTAGTTTGCTGCCAAATTTTTGTAACTATATAAGAAATCATGCCAAAATTTTAGCAACTATACCAAATTTTTGGCATTGCCAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.50% 46.10% 0.59% 0.85% NA
All Indica  2759 58.30% 39.40% 0.91% 1.41% NA
All Japonica  1512 39.70% 60.30% 0.07% 0.00% NA
Aus  269 65.40% 34.20% 0.37% 0.00% NA
Indica I  595 37.30% 61.30% 1.01% 0.34% NA
Indica II  465 60.60% 38.30% 0.00% 1.08% NA
Indica III  913 66.50% 31.70% 0.66% 1.20% NA
Indica Intermediate  786 63.40% 32.30% 1.65% 2.67% NA
Temperate Japonica  767 11.50% 88.50% 0.00% 0.00% NA
Tropical Japonica  504 71.60% 28.20% 0.20% 0.00% NA
Japonica Intermediate  241 62.70% 37.30% 0.00% 0.00% NA
VI/Aromatic  96 50.00% 50.00% 0.00% 0.00% NA
Intermediate  90 51.10% 46.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431894926 G -> DEL N N silent_mutation Average:55.853; most accessible tissue: Callus, score: 95.185 N N N N
vg0431894926 G -> A LOC_Os04g53520.1 upstream_gene_variant ; 351.0bp to feature; MODIFIER silent_mutation Average:55.853; most accessible tissue: Callus, score: 95.185 N N N N
vg0431894926 G -> A LOC_Os04g53530.1 upstream_gene_variant ; 326.0bp to feature; MODIFIER silent_mutation Average:55.853; most accessible tissue: Callus, score: 95.185 N N N N
vg0431894926 G -> A LOC_Os04g53540.1 downstream_gene_variant ; 4792.0bp to feature; MODIFIER silent_mutation Average:55.853; most accessible tissue: Callus, score: 95.185 N N N N
vg0431894926 G -> A LOC_Os04g53540.4 downstream_gene_variant ; 4792.0bp to feature; MODIFIER silent_mutation Average:55.853; most accessible tissue: Callus, score: 95.185 N N N N
vg0431894926 G -> A LOC_Os04g53540.2 downstream_gene_variant ; 4792.0bp to feature; MODIFIER silent_mutation Average:55.853; most accessible tissue: Callus, score: 95.185 N N N N
vg0431894926 G -> A LOC_Os04g53540.3 downstream_gene_variant ; 4792.0bp to feature; MODIFIER silent_mutation Average:55.853; most accessible tissue: Callus, score: 95.185 N N N N
vg0431894926 G -> A LOC_Os04g53520-LOC_Os04g53530 intergenic_region ; MODIFIER silent_mutation Average:55.853; most accessible tissue: Callus, score: 95.185 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431894926 NA 5.47E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431894926 NA 4.94E-16 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431894926 NA 1.21E-12 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431894926 NA 1.21E-08 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 2.45E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 5.99E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 9.53E-06 mr1006_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 3.24E-07 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 5.85E-07 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 3.86E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 8.48E-06 mr1084_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 4.87E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 4.67E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 1.23E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 1.24E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 1.13E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 3.58E-10 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 1.18E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 5.39E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 6.44E-06 mr1269_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 7.85E-06 mr1482_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 2.03E-07 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 7.04E-09 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 1.01E-06 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 8.95E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 4.07E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 1.17E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 2.56E-13 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 6.97E-08 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 3.72E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 3.08E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 1.41E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 2.68E-06 mr1751_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 2.36E-06 mr1763_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 9.34E-11 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431894926 NA 5.31E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251