Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0431887812:

Variant ID: vg0431887812 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31887812
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.18, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGTATTAATGAATCAACATGAGCAAACCACATGGCTGCACAGGAAGATCAGTAATAGTTCACCCAACTCAGATAAGACGATGACTAGTTTAAATCAAC[C/T]
GGATAAAAGGATGTGTGGTGCAAAGAAATGCAGTTTGTTCTGCTAGTAGTACTGTAAAGGTTGTAACAATGATAATTCAGGATCATTGAGTGGTAGATAG

Reverse complement sequence

CTATCTACCACTCAATGATCCTGAATTATCATTGTTACAACCTTTACAGTACTACTAGCAGAACAAACTGCATTTCTTTGCACCACACATCCTTTTATCC[G/A]
GTTGATTTAAACTAGTCATCGTCTTATCTGAGTTGGGTGAACTATTACTGATCTTCCTGTGCAGCCATGTGGTTTGCTCATGTTGATTCATTAATACTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.20% 45.70% 0.02% 0.00% NA
All Indica  2759 54.40% 45.60% 0.04% 0.00% NA
All Japonica  1512 59.20% 40.80% 0.00% 0.00% NA
Aus  269 26.80% 73.20% 0.00% 0.00% NA
Indica I  595 79.80% 20.20% 0.00% 0.00% NA
Indica II  465 69.90% 30.10% 0.00% 0.00% NA
Indica III  913 37.10% 62.90% 0.00% 0.00% NA
Indica Intermediate  786 45.90% 53.90% 0.13% 0.00% NA
Temperate Japonica  767 86.70% 13.30% 0.00% 0.00% NA
Tropical Japonica  504 27.60% 72.40% 0.00% 0.00% NA
Japonica Intermediate  241 37.80% 62.20% 0.00% 0.00% NA
VI/Aromatic  96 50.00% 50.00% 0.00% 0.00% NA
Intermediate  90 53.30% 46.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431887812 C -> T LOC_Os04g53520.1 intron_variant ; MODIFIER silent_mutation Average:37.307; most accessible tissue: Zhenshan97 young leaf, score: 53.314 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431887812 NA 2.59E-20 Heading_date All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431887812 NA 5.66E-15 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431887812 NA 6.28E-23 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431887812 NA 2.38E-17 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431887812 NA 2.17E-07 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431887812 NA 3.41E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431887812 NA 1.42E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 8.42E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 1.29E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 1.86E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 5.62E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 1.18E-06 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 5.86E-07 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 7.37E-07 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 7.54E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 6.65E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 1.08E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 1.34E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 7.06E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 4.57E-10 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 2.01E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 3.64E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 8.89E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 1.02E-06 mr1359_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 9.73E-07 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 9.38E-06 mr1482_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 2.26E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 3.09E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 2.49E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 4.02E-13 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 8.57E-08 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 7.28E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 4.72E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 5.91E-06 mr1763_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431887812 NA 8.43E-11 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251