\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431831099:

Variant ID: vg0431831099 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31831099
Reference Allele: CAlternative Allele: T,G
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.19, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:


GTGTGAATACCATCCAAGTATTCTCAGACTGCACCATGATAGACTTCAATTGACTTTTTTTTTAAAAAAAAAAAACTACTTCATCTGTCCCAAAATAAGT[C/T,G]
CAGCCCTGAGTAGAATTCAATTGATTTAATATTAACTTCTGCCAGATTCCGCAAGGACAACAATACCGGATGCACATGTCAGTAATGAAAAAGCAAAGTC

Reverse complement sequence

GACTTTGCTTTTTCATTACTGACATGTGCATCCGGTATTGTTGTCCTTGCGGAATCTGGCAGAAGTTAATATTAAATCAATTGAATTCTACTCAGGGCTG[G/A,C]
ACTTATTTTGGGACAGATGAAGTAGTTTTTTTTTTTTAAAAAAAAAGTCAATTGAAGTCTATCATGGTGCAGTCTGAGAATACTTGGATGGTATTCACAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.10% 46.30% 0.34% 0.00% G: 0.28%
All Indica  2759 54.80% 44.40% 0.40% 0.00% G: 0.40%
All Japonica  1512 45.70% 54.00% 0.26% 0.00% NA
Aus  269 66.90% 32.30% 0.00% 0.00% G: 0.74%
Indica I  595 41.50% 56.60% 0.84% 0.00% G: 1.01%
Indica II  465 75.90% 24.10% 0.00% 0.00% NA
Indica III  913 49.40% 50.50% 0.11% 0.00% NA
Indica Intermediate  786 58.70% 40.10% 0.64% 0.00% G: 0.64%
Temperate Japonica  767 21.00% 78.70% 0.26% 0.00% NA
Tropical Japonica  504 73.60% 26.20% 0.20% 0.00% NA
Japonica Intermediate  241 66.00% 33.60% 0.41% 0.00% NA
VI/Aromatic  96 81.20% 18.80% 0.00% 0.00% NA
Intermediate  90 55.60% 43.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431831099 C -> G LOC_Os04g53450.1 downstream_gene_variant ; 2173.0bp to feature; MODIFIER silent_mutation Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 N N N N
vg0431831099 C -> G LOC_Os04g53460.1 downstream_gene_variant ; 8.0bp to feature; MODIFIER silent_mutation Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 N N N N
vg0431831099 C -> G LOC_Os04g53460.2 downstream_gene_variant ; 8.0bp to feature; MODIFIER silent_mutation Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 N N N N
vg0431831099 C -> G LOC_Os04g53460.3 downstream_gene_variant ; 8.0bp to feature; MODIFIER silent_mutation Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 N N N N
vg0431831099 C -> G LOC_Os04g53460.4 downstream_gene_variant ; 8.0bp to feature; MODIFIER silent_mutation Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 N N N N
vg0431831099 C -> G LOC_Os04g53450-LOC_Os04g53460 intergenic_region ; MODIFIER silent_mutation Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 N N N N
vg0431831099 C -> T LOC_Os04g53450.1 downstream_gene_variant ; 2173.0bp to feature; MODIFIER silent_mutation Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 N N N N
vg0431831099 C -> T LOC_Os04g53460.1 downstream_gene_variant ; 8.0bp to feature; MODIFIER silent_mutation Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 N N N N
vg0431831099 C -> T LOC_Os04g53460.2 downstream_gene_variant ; 8.0bp to feature; MODIFIER silent_mutation Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 N N N N
vg0431831099 C -> T LOC_Os04g53460.3 downstream_gene_variant ; 8.0bp to feature; MODIFIER silent_mutation Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 N N N N
vg0431831099 C -> T LOC_Os04g53460.4 downstream_gene_variant ; 8.0bp to feature; MODIFIER silent_mutation Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 N N N N
vg0431831099 C -> T LOC_Os04g53450-LOC_Os04g53460 intergenic_region ; MODIFIER silent_mutation Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431831099 NA 2.13E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431831099 NA 9.43E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431831099 NA 1.58E-16 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431831099 6.37E-06 NA mr1003 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431831099 NA 1.02E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431831099 NA 8.43E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431831099 NA 1.53E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431831099 NA 4.85E-06 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431831099 NA 8.35E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431831099 NA 4.16E-09 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251