| Variant ID: vg0431831099 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 31831099 |
| Reference Allele: C | Alternative Allele: T,G |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.19, others allele: 0.00, population size: 182. )
GTGTGAATACCATCCAAGTATTCTCAGACTGCACCATGATAGACTTCAATTGACTTTTTTTTTAAAAAAAAAAAACTACTTCATCTGTCCCAAAATAAGT[C/T,G]
CAGCCCTGAGTAGAATTCAATTGATTTAATATTAACTTCTGCCAGATTCCGCAAGGACAACAATACCGGATGCACATGTCAGTAATGAAAAAGCAAAGTC
GACTTTGCTTTTTCATTACTGACATGTGCATCCGGTATTGTTGTCCTTGCGGAATCTGGCAGAAGTTAATATTAAATCAATTGAATTCTACTCAGGGCTG[G/A,C]
ACTTATTTTGGGACAGATGAAGTAGTTTTTTTTTTTTAAAAAAAAAGTCAATTGAAGTCTATCATGGTGCAGTCTGAGAATACTTGGATGGTATTCACAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.10% | 46.30% | 0.34% | 0.00% | G: 0.28% |
| All Indica | 2759 | 54.80% | 44.40% | 0.40% | 0.00% | G: 0.40% |
| All Japonica | 1512 | 45.70% | 54.00% | 0.26% | 0.00% | NA |
| Aus | 269 | 66.90% | 32.30% | 0.00% | 0.00% | G: 0.74% |
| Indica I | 595 | 41.50% | 56.60% | 0.84% | 0.00% | G: 1.01% |
| Indica II | 465 | 75.90% | 24.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 49.40% | 50.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 58.70% | 40.10% | 0.64% | 0.00% | G: 0.64% |
| Temperate Japonica | 767 | 21.00% | 78.70% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 73.60% | 26.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.00% | 33.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 43.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0431831099 | C -> G | LOC_Os04g53450.1 | downstream_gene_variant ; 2173.0bp to feature; MODIFIER | silent_mutation | Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 | N | N | N | N |
| vg0431831099 | C -> G | LOC_Os04g53460.1 | downstream_gene_variant ; 8.0bp to feature; MODIFIER | silent_mutation | Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 | N | N | N | N |
| vg0431831099 | C -> G | LOC_Os04g53460.2 | downstream_gene_variant ; 8.0bp to feature; MODIFIER | silent_mutation | Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 | N | N | N | N |
| vg0431831099 | C -> G | LOC_Os04g53460.3 | downstream_gene_variant ; 8.0bp to feature; MODIFIER | silent_mutation | Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 | N | N | N | N |
| vg0431831099 | C -> G | LOC_Os04g53460.4 | downstream_gene_variant ; 8.0bp to feature; MODIFIER | silent_mutation | Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 | N | N | N | N |
| vg0431831099 | C -> G | LOC_Os04g53450-LOC_Os04g53460 | intergenic_region ; MODIFIER | silent_mutation | Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 | N | N | N | N |
| vg0431831099 | C -> T | LOC_Os04g53450.1 | downstream_gene_variant ; 2173.0bp to feature; MODIFIER | silent_mutation | Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 | N | N | N | N |
| vg0431831099 | C -> T | LOC_Os04g53460.1 | downstream_gene_variant ; 8.0bp to feature; MODIFIER | silent_mutation | Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 | N | N | N | N |
| vg0431831099 | C -> T | LOC_Os04g53460.2 | downstream_gene_variant ; 8.0bp to feature; MODIFIER | silent_mutation | Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 | N | N | N | N |
| vg0431831099 | C -> T | LOC_Os04g53460.3 | downstream_gene_variant ; 8.0bp to feature; MODIFIER | silent_mutation | Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 | N | N | N | N |
| vg0431831099 | C -> T | LOC_Os04g53460.4 | downstream_gene_variant ; 8.0bp to feature; MODIFIER | silent_mutation | Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 | N | N | N | N |
| vg0431831099 | C -> T | LOC_Os04g53450-LOC_Os04g53460 | intergenic_region ; MODIFIER | silent_mutation | Average:61.558; most accessible tissue: Minghui63 flower, score: 79.679 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0431831099 | NA | 2.13E-10 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0431831099 | NA | 9.43E-10 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0431831099 | NA | 1.58E-16 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0431831099 | 6.37E-06 | NA | mr1003 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431831099 | NA | 1.02E-07 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431831099 | NA | 8.43E-08 | mr1521_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431831099 | NA | 1.53E-06 | mr1592_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431831099 | NA | 4.85E-06 | mr1659_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431831099 | NA | 8.35E-07 | mr1671_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431831099 | NA | 4.16E-09 | mr1880_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |