\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431430568:

Variant ID: vg0431430568 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 31430568
Reference Allele: CAlternative Allele: T,CTGTACTCAAAAT
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGTGTATAGTTGATAGGTCTAGCATGCGTGTAGGGGTGTGTGTGTGCGTGGTGGAGTGCGTTTGCACGTATGTTCAGATACTACAGCTTGTACTCAAAG[C/T,CTGTACTCAAAAT]
GGAGAGCTCTCAAAAAAAAAATTGTACAGGCATCTGTTGGGCTAAATTCTCTCTGCAGGAGCTTTTTGCTCTTAGCCCATTGTAGCTTAAAGGTCCAACA

Reverse complement sequence

TGTTGGACCTTTAAGCTACAATGGGCTAAGAGCAAAAAGCTCCTGCAGAGAGAATTTAGCCCAACAGATGCCTGTACAATTTTTTTTTTGAGAGCTCTCC[G/A,ATTTTGAGTACAG]
CTTTGAGTACAAGCTGTAGTATCTGAACATACGTGCAAACGCACTCCACCACGCACACACACACCCCTACACGCATGCTAGACCTATCAACTATACACAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.60% 12.80% 4.82% 28.33% CTGTACTCAAAAT: 0.44%
All Indica  2759 74.70% 7.10% 5.98% 12.14% CTGTACTCAAAAT: 0.07%
All Japonica  1512 20.00% 22.00% 1.79% 56.22% NA
Aus  269 17.50% 20.10% 8.92% 46.47% CTGTACTCAAAAT: 7.06%
Indica I  595 65.50% 20.20% 4.20% 10.08% NA
Indica II  465 66.50% 1.50% 10.32% 21.72% NA
Indica III  913 83.50% 0.90% 6.13% 9.42% CTGTACTCAAAAT: 0.11%
Indica Intermediate  786 76.50% 7.60% 4.58% 11.20% CTGTACTCAAAAT: 0.13%
Temperate Japonica  767 17.30% 39.40% 1.56% 41.72% NA
Tropical Japonica  504 14.30% 2.20% 2.18% 81.35% NA
Japonica Intermediate  241 40.20% 8.30% 1.66% 49.79% NA
VI/Aromatic  96 80.20% 15.60% 2.08% 2.08% NA
Intermediate  90 51.10% 7.80% 11.11% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431430568 C -> DEL N N silent_mutation Average:66.021; most accessible tissue: Zhenshan97 flag leaf, score: 85.638 N N N N
vg0431430568 C -> CTGTACTCAAAAT LOC_Os04g52790.1 downstream_gene_variant ; 1865.0bp to feature; MODIFIER silent_mutation Average:66.021; most accessible tissue: Zhenshan97 flag leaf, score: 85.638 N N N N
vg0431430568 C -> CTGTACTCAAAAT LOC_Os04g52800.1 downstream_gene_variant ; 4367.0bp to feature; MODIFIER silent_mutation Average:66.021; most accessible tissue: Zhenshan97 flag leaf, score: 85.638 N N N N
vg0431430568 C -> CTGTACTCAAAAT LOC_Os04g52780-LOC_Os04g52790 intergenic_region ; MODIFIER silent_mutation Average:66.021; most accessible tissue: Zhenshan97 flag leaf, score: 85.638 N N N N
vg0431430568 C -> T LOC_Os04g52790.1 downstream_gene_variant ; 1866.0bp to feature; MODIFIER silent_mutation Average:66.021; most accessible tissue: Zhenshan97 flag leaf, score: 85.638 N N N N
vg0431430568 C -> T LOC_Os04g52800.1 downstream_gene_variant ; 4368.0bp to feature; MODIFIER silent_mutation Average:66.021; most accessible tissue: Zhenshan97 flag leaf, score: 85.638 N N N N
vg0431430568 C -> T LOC_Os04g52780-LOC_Os04g52790 intergenic_region ; MODIFIER silent_mutation Average:66.021; most accessible tissue: Zhenshan97 flag leaf, score: 85.638 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431430568 C CTGTA* -0.17 0.09 -0.09 -0.08 0.02 0.05
vg0431430568 C T -0.1 -0.03 -0.05 -0.04 -0.04 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431430568 7.50E-06 NA Yield All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431430568 NA 9.56E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431430568 NA 4.29E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431430568 NA 8.11E-06 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251