\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431362633:

Variant ID: vg0431362633 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31362633
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.84, G: 0.15, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCTCCCCCCTCACCTTCCCGTGTTAAACCGCGTCAGATTGCAGCTAGGGGGCGGAATCGATAGCATCTTCTTTAGAAACGAAGTTTGATCCATTGGTA[G/A]
TCGATCATATTTATCATTTAATCAATACGATATAGAAAAATAATTAAAAAAACAAAAATTATGTATAACAAGAGAGGGCAACGGTCGGAAACAGTATCCG

Reverse complement sequence

CGGATACTGTTTCCGACCGTTGCCCTCTCTTGTTATACATAATTTTTGTTTTTTTAATTATTTTTCTATATCGTATTGATTAAATGATAAATATGATCGA[C/T]
TACCAATGGATCAAACTTCGTTTCTAAAGAAGATGCTATCGATTCCGCCCCCTAGCTGCAATCTGACGCGGTTTAACACGGGAAGGTGAGGGGGGAGAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.70% 18.60% 0.53% 3.20% NA
All Indica  2759 88.30% 6.40% 0.54% 4.71% NA
All Japonica  1512 54.70% 45.00% 0.20% 0.07% NA
Aus  269 92.60% 0.70% 2.60% 4.09% NA
Indica I  595 77.00% 21.80% 0.34% 0.84% NA
Indica II  465 95.90% 3.90% 0.00% 0.22% NA
Indica III  913 90.60% 0.10% 0.22% 9.09% NA
Indica Intermediate  786 89.80% 3.60% 1.40% 5.22% NA
Temperate Japonica  767 18.90% 81.00% 0.00% 0.13% NA
Tropical Japonica  504 97.60% 2.40% 0.00% 0.00% NA
Japonica Intermediate  241 78.80% 19.90% 1.24% 0.00% NA
VI/Aromatic  96 90.60% 0.00% 0.00% 9.38% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431362633 G -> DEL N N silent_mutation Average:88.384; most accessible tissue: Zhenshan97 flag leaf, score: 96.346 N N N N
vg0431362633 G -> A LOC_Os04g52684.1 downstream_gene_variant ; 4605.0bp to feature; MODIFIER silent_mutation Average:88.384; most accessible tissue: Zhenshan97 flag leaf, score: 96.346 N N N N
vg0431362633 G -> A LOC_Os04g52690.1 downstream_gene_variant ; 1410.0bp to feature; MODIFIER silent_mutation Average:88.384; most accessible tissue: Zhenshan97 flag leaf, score: 96.346 N N N N
vg0431362633 G -> A LOC_Os04g52690.2 downstream_gene_variant ; 1410.0bp to feature; MODIFIER silent_mutation Average:88.384; most accessible tissue: Zhenshan97 flag leaf, score: 96.346 N N N N
vg0431362633 G -> A LOC_Os04g52690.3 downstream_gene_variant ; 1410.0bp to feature; MODIFIER silent_mutation Average:88.384; most accessible tissue: Zhenshan97 flag leaf, score: 96.346 N N N N
vg0431362633 G -> A LOC_Os04g52684-LOC_Os04g52690 intergenic_region ; MODIFIER silent_mutation Average:88.384; most accessible tissue: Zhenshan97 flag leaf, score: 96.346 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431362633 G A -0.09 0.01 0.0 0.02 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431362633 NA 9.71E-12 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431362633 NA 9.07E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431362633 NA 2.08E-14 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431362633 NA 3.30E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431362633 NA 3.79E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 3.58E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 9.38E-06 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 6.34E-08 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 6.70E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 1.31E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 1.40E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 4.66E-07 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 7.20E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 2.56E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 2.00E-12 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 6.12E-18 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 5.37E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 1.69E-14 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 4.44E-06 NA mr1082_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 2.16E-14 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 3.40E-07 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 5.45E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 2.85E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 1.64E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 4.76E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 2.81E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 7.54E-06 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 1.89E-08 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 1.09E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 2.22E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 1.61E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 1.34E-12 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 8.26E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 4.81E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 9.84E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 9.93E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431362633 NA 7.53E-09 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251