\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428888367:

Variant ID: vg0428888367 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 28888367
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGTAAAATACAACGTCGATCCTTAAAGATGGGACGTGATATCACTTTATTCATCTTGTAAATTCAATCTTTAGGTTTATAATCTTGTTTTAATGTACC[A/G]
ACCAGGTCCAAATCTCATTTTACTGTGTTTGACCATTGATGTGGCAGTCCGGCATGGTCACATCCTTGTATTTACCGGTTTACCCTCTCCGTGACCCTTA

Reverse complement sequence

TAAGGGTCACGGAGAGGGTAAACCGGTAAATACAAGGATGTGACCATGCCGGACTGCCACATCAATGGTCAAACACAGTAAAATGAGATTTGGACCTGGT[T/C]
GGTACATTAAAACAAGATTATAAACCTAAAGATTGAATTTACAAGATGAATAAAGTGATATCACGTCCCATCTTTAAGGATCGACGTTGTATTTTACAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.70% 8.50% 0.85% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 72.50% 25.30% 2.18% 0.00% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 49.50% 46.40% 4.04% 0.00% NA
Tropical Japonica  504 97.20% 2.60% 0.20% 0.00% NA
Japonica Intermediate  241 93.80% 5.80% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 10.00% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0428888367 A -> G LOC_Os04g48460.1 upstream_gene_variant ; 4194.0bp to feature; MODIFIER silent_mutation Average:55.82; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0428888367 A -> G LOC_Os04g48460.2 upstream_gene_variant ; 4194.0bp to feature; MODIFIER silent_mutation Average:55.82; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0428888367 A -> G LOC_Os04g48440.1 downstream_gene_variant ; 1579.0bp to feature; MODIFIER silent_mutation Average:55.82; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0428888367 A -> G LOC_Os04g48450.1 downstream_gene_variant ; 98.0bp to feature; MODIFIER silent_mutation Average:55.82; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0428888367 A -> G LOC_Os04g48440-LOC_Os04g48450 intergenic_region ; MODIFIER silent_mutation Average:55.82; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0428888367 NA 6.92E-13 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0428888367 NA 2.25E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0428888367 NA 8.91E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0428888367 NA 1.00E-13 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0428888367 NA 3.11E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367 5.37E-07 6.03E-25 mr1010_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367 NA 1.90E-13 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367 NA 6.04E-12 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367 NA 9.04E-08 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367 8.46E-06 1.36E-16 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367 NA 1.85E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367 NA 3.85E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367 NA 3.52E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367 NA 5.54E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367 NA 9.96E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367 NA 1.23E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367 NA 1.19E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367 NA 3.12E-10 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367 NA 8.09E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367 NA 7.47E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367 NA 1.77E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251