Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428888367:

Variant ID: vg0428888367 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 28888367
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:

ATTGTAAAATACAACGTCGATCCTTAAAGATGGGACGTGATATCACTTTATTCATCTTGTAAATTCAATCTTTAGGTTTATAATCTTGTTTTAATGTACC[A/G]
ACCAGGTCCAAATCTCATTTTACTGTGTTTGACCATTGATGTGGCAGTCCGGCATGGTCACATCCTTGTATTTACCGGTTTACCCTCTCCGTGACCCTTA

Reverse complement sequence

TAAGGGTCACGGAGAGGGTAAACCGGTAAATACAAGGATGTGACCATGCCGGACTGCCACATCAATGGTCAAACACAGTAAAATGAGATTTGGACCTGGT[T/C]
GGTACATTAAAACAAGATTATAAACCTAAAGATTGAATTTACAAGATGAATAAAGTGATATCACGTCCCATCTTTAAGGATCGACGTTGTATTTTACAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.70%	8.50%	0.85%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.00%	0.00%	NA
All Japonica	1512	72.50%	25.30%	2.18%	0.00%	NA
Aus	269	99.30%	0.00%	0.74%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.10%	0.90%	0.00%	0.00%	NA
Temperate Japonica	767	49.50%	46.40%	4.04%	0.00%	NA
Tropical Japonica	504	97.20%	2.60%	0.20%	0.00%	NA
Japonica Intermediate	241	93.80%	5.80%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	10.00%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0428888367	A -> G	LOC_Os04g48460.1	upstream_gene_variant ; 4194.0bp to feature; MODIFIER	silent_mutation	Average:55.82; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0428888367	A -> G	LOC_Os04g48460.2	upstream_gene_variant ; 4194.0bp to feature; MODIFIER	silent_mutation	Average:55.82; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0428888367	A -> G	LOC_Os04g48440.1	downstream_gene_variant ; 1579.0bp to feature; MODIFIER	silent_mutation	Average:55.82; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0428888367	A -> G	LOC_Os04g48450.1	downstream_gene_variant ; 98.0bp to feature; MODIFIER	silent_mutation	Average:55.82; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0428888367	A -> G	LOC_Os04g48440-LOC_Os04g48450	intergenic_region ; MODIFIER	silent_mutation	Average:55.82; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0428888367	NA	6.92E-13	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0428888367	NA	2.25E-10	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0428888367	NA	8.91E-12	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0428888367	NA	1.00E-13	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0428888367	NA	3.11E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367	5.37E-07	6.03E-25	mr1010_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367	NA	1.90E-13	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367	NA	6.04E-12	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367	NA	9.04E-08	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367	8.46E-06	1.36E-16	mr1013_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367	NA	1.85E-07	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367	NA	3.85E-15	mr1031_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367	NA	3.52E-08	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367	NA	5.54E-07	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367	NA	9.96E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367	NA	1.23E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367	NA	1.19E-06	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367	NA	3.12E-10	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367	NA	8.09E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367	NA	7.47E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428888367	NA	1.77E-08	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251