Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427274146:

Variant ID: vg0427274146 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 27274146
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCACCTCACCTGACTCCCTCCCAACGCGCACACGCACCACCACCACCGCATCAAATGCGCCCGCGCGCCCCGTACGCGACGTGCCTTCTCGCGGGCGCTG[T/C]
TGCTGCCCCCGGCCGCCCGCTTGGGTTGGGTTGGTTGCGTTTTTTCTGTGTTGGTTCCACGTCATGTGAACCGAGCCGGAACTAAAACAAGTATAATCAA

Reverse complement sequence

TTGATTATACTTGTTTTAGTTCCGGCTCGGTTCACATGACGTGGAACCAACACAGAAAAAACGCAACCAACCCAACCCAAGCGGGCGGCCGGGGGCAGCA[A/G]
CAGCGCCCGCGAGAAGGCACGTCGCGTACGGGGCGCGCGGGCGCATTTGATGCGGTGGTGGTGGTGCGTGTGCGCGTTGGGAGGGAGTCAGGTGAGGTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.90% 11.90% 3.20% 0.00% NA
All Indica  2759 98.10% 0.90% 0.94% 0.00% NA
All Japonica  1512 58.00% 34.00% 8.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 96.10% 1.80% 2.02% 0.00% NA
Indica II  465 99.40% 0.20% 0.43% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 97.10% 1.40% 1.53% 0.00% NA
Temperate Japonica  767 26.20% 60.80% 13.04% 0.00% NA
Tropical Japonica  504 97.00% 1.20% 1.79% 0.00% NA
Japonica Intermediate  241 77.60% 17.40% 4.98% 0.00% NA
VI/Aromatic  96 91.70% 7.30% 1.04% 0.00% NA
Intermediate  90 82.20% 14.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0427274146 T -> C LOC_Os04g46040.1 downstream_gene_variant ; 1932.0bp to feature; MODIFIER silent_mutation Average:98.016; most accessible tissue: Zhenshan97 root, score: 99.743 N N N N
vg0427274146 T -> C LOC_Os04g46050.1 downstream_gene_variant ; 1069.0bp to feature; MODIFIER silent_mutation Average:98.016; most accessible tissue: Zhenshan97 root, score: 99.743 N N N N
vg0427274146 T -> C LOC_Os04g46050.2 downstream_gene_variant ; 1069.0bp to feature; MODIFIER silent_mutation Average:98.016; most accessible tissue: Zhenshan97 root, score: 99.743 N N N N
vg0427274146 T -> C LOC_Os04g46050.3 downstream_gene_variant ; 1069.0bp to feature; MODIFIER silent_mutation Average:98.016; most accessible tissue: Zhenshan97 root, score: 99.743 N N N N
vg0427274146 T -> C LOC_Os04g46040-LOC_Os04g46050 intergenic_region ; MODIFIER silent_mutation Average:98.016; most accessible tissue: Zhenshan97 root, score: 99.743 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0427274146 T C 0.01 -0.03 -0.02 0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0427274146 NA 1.18E-16 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0427274146 NA 2.60E-15 Heading_date Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0427274146 NA 2.20E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0427274146 NA 9.58E-15 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0427274146 NA 5.40E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0427274146 NA 1.33E-06 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 1.05E-22 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 5.68E-12 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 4.34E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 9.29E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 1.53E-15 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 9.83E-08 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 1.20E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 1.11E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 3.94E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 9.31E-07 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 7.53E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 1.16E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 2.66E-08 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 2.10E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 7.85E-09 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 9.56E-06 2.02E-11 mr1263_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 3.68E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 3.51E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 2.93E-06 mr1668_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 2.06E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 4.60E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 1.46E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 3.22E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 9.22E-15 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 5.16E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427274146 NA 6.40E-08 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251