\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0426777183:

Variant ID: vg0426777183 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 26777183
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAACCGCGGACCGGGGAACGTACCGGGTGTACGGTTTCCCGCTCTTGCACTTAAGGACCGTTTCCTTGGAATTTCATCCAAACATAAGACAAGTACGAC[T/C]
ACATGGGTGGAATGGGACACCCCTGGTTGAGTAACTAGCTTATCAGGGGAGCCTTGATGCCGAGAGACATGTGGATTCGCCGGGGTGGTGTTGGGGAGGA

Reverse complement sequence

TCCTCCCCAACACCACCCCGGCGAATCCACATGTCTCTCGGCATCAAGGCTCCCCTGATAAGCTAGTTACTCAACCAGGGGTGTCCCATTCCACCCATGT[A/G]
GTCGTACTTGTCTTATGTTTGGATGAAATTCCAAGGAAACGGTCCTTAAGTGCAAGAGCGGGAAACCGTACACCCGGTACGTTCCCCGGTCCGCGGTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.90% 15.80% 12.23% 0.06% NA
All Indica  2759 83.60% 5.20% 11.24% 0.00% NA
All Japonica  1512 51.40% 38.20% 10.45% 0.00% NA
Aus  269 62.80% 3.30% 33.09% 0.74% NA
Indica I  595 65.20% 11.40% 23.36% 0.00% NA
Indica II  465 89.00% 4.70% 6.24% 0.00% NA
Indica III  913 94.20% 0.90% 4.93% 0.00% NA
Indica Intermediate  786 81.90% 5.70% 12.34% 0.00% NA
Temperate Japonica  767 18.50% 68.70% 12.78% 0.00% NA
Tropical Japonica  504 91.70% 1.80% 6.55% 0.00% NA
Japonica Intermediate  241 71.80% 17.00% 11.20% 0.00% NA
VI/Aromatic  96 91.70% 1.00% 7.29% 0.00% NA
Intermediate  90 62.20% 21.10% 15.56% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0426777183 T -> C LOC_Os04g45300.1 upstream_gene_variant ; 1821.0bp to feature; MODIFIER silent_mutation Average:20.345; most accessible tissue: Minghui63 flower, score: 32.19 N N N N
vg0426777183 T -> C LOC_Os04g45310.1 downstream_gene_variant ; 4002.0bp to feature; MODIFIER silent_mutation Average:20.345; most accessible tissue: Minghui63 flower, score: 32.19 N N N N
vg0426777183 T -> C LOC_Os04g45300-LOC_Os04g45310 intergenic_region ; MODIFIER silent_mutation Average:20.345; most accessible tissue: Minghui63 flower, score: 32.19 N N N N
vg0426777183 T -> DEL N N silent_mutation Average:20.345; most accessible tissue: Minghui63 flower, score: 32.19 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0426777183 NA 7.70E-12 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0426777183 NA 2.49E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0426777183 NA 4.64E-15 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0426777183 NA 1.03E-16 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0426777183 NA 5.80E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0426777183 NA 8.26E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 9.53E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 8.84E-07 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 9.74E-06 9.73E-06 mr1122 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 4.84E-06 NA mr1128 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 2.25E-06 mr1154 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 3.31E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 2.70E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 3.92E-10 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 2.39E-08 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 6.69E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 7.64E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 2.02E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 2.08E-08 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 7.78E-06 mr1896 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 6.69E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 4.83E-23 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 2.69E-11 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 3.60E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 3.65E-06 NA mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 6.57E-09 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 3.94E-08 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 8.24E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 5.78E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 7.38E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 9.24E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 2.05E-06 1.83E-12 mr1576_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 3.12E-06 4.33E-09 mr1576_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 1.41E-07 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 1.20E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426777183 NA 9.28E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251