\
| Variant ID: vg0426619931 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 26619931 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAATTCAATGTTTGCAAATACATGTACGTAGTTGATAATAGTTTGCCTCTTTTAGAAGGGGAAATACATGATATGACATTAACTTCACATCTATTTGAGA[T/A]
TTTTTTTTTTCTTCTCGAGACCTATTTGGAATTTGAACAAAAGATTAACATAAGATCTTGGACATCATATTACATTTGAAAGAGGATTAGATGGAAAGAA
TTCTTTCCATCTAATCCTCTTTCAAATGTAATATGATGTCCAAGATCTTATGTTAATCTTTTGTTCAAATTCCAAATAGGTCTCGAGAAGAAAAAAAAAA[A/T]
TCTCAAATAGATGTGAAGTTAATGTCATATCATGTATTTCCCCTTCTAAAAGAGGCAAACTATTATCAACTACGTACATGTATTTGCAAACATTGAATTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.60% | 19.20% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 95.20% | 4.70% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 59.30% | 40.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 53.20% | 46.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.80% | 2.90% | 0.34% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.60% | 6.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 5.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 32.50% | 67.30% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.10% | 24.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 25.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0426619931 | T -> A | LOC_Os04g44990.1 | upstream_gene_variant ; 3573.0bp to feature; MODIFIER | silent_mutation | Average:75.772; most accessible tissue: Minghui63 flag leaf, score: 88.103 | N | N | N | N |
| vg0426619931 | T -> A | LOC_Os04g45000.4 | downstream_gene_variant ; 822.0bp to feature; MODIFIER | silent_mutation | Average:75.772; most accessible tissue: Minghui63 flag leaf, score: 88.103 | N | N | N | N |
| vg0426619931 | T -> A | LOC_Os04g45010.1 | downstream_gene_variant ; 1086.0bp to feature; MODIFIER | silent_mutation | Average:75.772; most accessible tissue: Minghui63 flag leaf, score: 88.103 | N | N | N | N |
| vg0426619931 | T -> A | LOC_Os04g45000.1 | downstream_gene_variant ; 822.0bp to feature; MODIFIER | silent_mutation | Average:75.772; most accessible tissue: Minghui63 flag leaf, score: 88.103 | N | N | N | N |
| vg0426619931 | T -> A | LOC_Os04g45000.3 | downstream_gene_variant ; 822.0bp to feature; MODIFIER | silent_mutation | Average:75.772; most accessible tissue: Minghui63 flag leaf, score: 88.103 | N | N | N | N |
| vg0426619931 | T -> A | LOC_Os04g45000.2 | downstream_gene_variant ; 822.0bp to feature; MODIFIER | silent_mutation | Average:75.772; most accessible tissue: Minghui63 flag leaf, score: 88.103 | N | N | N | N |
| vg0426619931 | T -> A | LOC_Os04g45000-LOC_Os04g45010 | intergenic_region ; MODIFIER | silent_mutation | Average:75.772; most accessible tissue: Minghui63 flag leaf, score: 88.103 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0426619931 | NA | 1.40E-10 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0426619931 | NA | 1.63E-11 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0426619931 | NA | 9.24E-16 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0426619931 | NA | 1.46E-12 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0426619931 | NA | 1.80E-07 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 2.52E-06 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 7.57E-08 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 1.08E-06 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 6.25E-08 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 3.64E-06 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 1.65E-08 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 4.26E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 1.75E-08 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 2.04E-06 | mr1051_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 6.63E-06 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 3.21E-06 | mr1072_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 6.45E-10 | mr1077_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 4.41E-07 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 6.10E-06 | mr1206_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 1.16E-08 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 5.35E-08 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 1.08E-09 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 2.01E-06 | mr1252_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 4.80E-06 | mr1263_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 3.02E-06 | mr1359_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 5.46E-06 | mr1380_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 1.56E-06 | mr1441_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 6.23E-06 | mr1561_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 2.69E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 6.58E-06 | mr1596_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 8.45E-08 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 4.71E-08 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 2.33E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 3.55E-10 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 1.95E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 2.36E-09 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 2.05E-08 | mr1880_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 5.19E-15 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426619931 | NA | 4.34E-07 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |