\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0426102441:

Variant ID: vg0426102441 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 26102441
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGATTCACATTACGAAGAATAGAGTGAAGCGAGCTGAAGTTGTAGCCCTAATGAGTTAAATTTAGATCTAACTAAAAATAGAGTTAAATTTAGACTTTA[T/A]
TTCTATTTAAATACCAAACTACGAAATCATATCACTCAAAGTTATTTTTGAGTCATAAGAGATACACATCTTTAAATAAATAAATTGATAAATCTATATA

Reverse complement sequence

TATATAGATTTATCAATTTATTTATTTAAAGATGTGTATCTCTTATGACTCAAAAATAACTTTGAGTGATATGATTTCGTAGTTTGGTATTTAAATAGAA[A/T]
TAAAGTCTAAATTTAACTCTATTTTTAGTTAGATCTAAATTTAACTCATTAGGGCTACAACTTCAGCTCGCTTCACTCTATTCTTCGTAATGTGAATCTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.80% 12.80% 0.40% 0.00% NA
All Indica  2759 98.30% 1.60% 0.11% 0.00% NA
All Japonica  1512 64.00% 34.90% 1.06% 0.00% NA
Aus  269 97.00% 3.00% 0.00% 0.00% NA
Indica I  595 97.50% 2.40% 0.17% 0.00% NA
Indica II  465 98.30% 1.50% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 97.10% 2.80% 0.13% 0.00% NA
Temperate Japonica  767 32.50% 65.60% 1.96% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 91.30% 8.30% 0.41% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0426102441 T -> A LOC_Os04g44070.1 upstream_gene_variant ; 1422.0bp to feature; MODIFIER silent_mutation Average:61.088; most accessible tissue: Minghui63 root, score: 87.364 N N N N
vg0426102441 T -> A LOC_Os04g44080.1 upstream_gene_variant ; 4041.0bp to feature; MODIFIER silent_mutation Average:61.088; most accessible tissue: Minghui63 root, score: 87.364 N N N N
vg0426102441 T -> A LOC_Os04g44050.1 downstream_gene_variant ; 3441.0bp to feature; MODIFIER silent_mutation Average:61.088; most accessible tissue: Minghui63 root, score: 87.364 N N N N
vg0426102441 T -> A LOC_Os04g44060.1 downstream_gene_variant ; 659.0bp to feature; MODIFIER silent_mutation Average:61.088; most accessible tissue: Minghui63 root, score: 87.364 N N N N
vg0426102441 T -> A LOC_Os04g44060-LOC_Os04g44070 intergenic_region ; MODIFIER silent_mutation Average:61.088; most accessible tissue: Minghui63 root, score: 87.364 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0426102441 NA 2.89E-12 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0426102441 NA 6.07E-13 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0426102441 NA 6.54E-16 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0426102441 NA 1.03E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0426102441 NA 8.18E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 6.71E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 1.02E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 5.36E-08 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 8.71E-08 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 3.61E-06 1.98E-13 mr1940 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 2.61E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 4.84E-08 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 3.92E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 5.22E-08 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 1.71E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 2.57E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 1.25E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 2.94E-08 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 7.68E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 3.00E-07 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 1.78E-08 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 4.84E-06 mr1576_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 1.88E-07 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 4.07E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 3.44E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 4.05E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 1.02E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 1.26E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 2.89E-16 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426102441 NA 6.41E-09 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251