\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0425944117:

Variant ID: vg0425944117 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 25944117
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGGCACCGTCGTCACAGTGGCTAAGGTTGACGCTCCGGAACGAACTGTATCAGGTTAGATAATCTAGAGAAAATCCAACACGCCGGAAGCCTCTAGGA[G/A]
GGGGGCTATAGATCCAGCAACGAAAAGGACGCGTAAGCAACCACGATTTGGACGTCTTTATTTAACCAAAACTGTTTCAGGTTTCTGTCGTCCTGATTGA

Reverse complement sequence

TCAATCAGGACGACAGAAACCTGAAACAGTTTTGGTTAAATAAAGACGTCCAAATCGTGGTTGCTTACGCGTCCTTTTCGTTGCTGGATCTATAGCCCCC[C/T]
TCCTAGAGGCTTCCGGCGTGTTGGATTTTCTCTAGATTATCTAACCTGATACAGTTCGTTCCGGAGCGTCAACCTTAGCCACTGTGACGACGGTGCCAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.70% 14.90% 7.43% 0.95% NA
All Indica  2759 86.60% 4.20% 7.76% 1.38% NA
All Japonica  1512 54.90% 37.50% 7.61% 0.00% NA
Aus  269 94.10% 0.70% 3.72% 1.49% NA
Indica I  595 70.10% 10.60% 19.33% 0.00% NA
Indica II  465 90.80% 2.60% 6.67% 0.00% NA
Indica III  913 95.60% 0.20% 0.44% 3.72% NA
Indica Intermediate  786 86.30% 5.10% 8.14% 0.51% NA
Temperate Japonica  767 22.40% 67.90% 9.65% 0.00% NA
Tropical Japonica  504 93.50% 2.40% 4.17% 0.00% NA
Japonica Intermediate  241 77.60% 14.10% 8.30% 0.00% NA
VI/Aromatic  96 91.70% 6.20% 1.04% 1.04% NA
Intermediate  90 70.00% 15.60% 12.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0425944117 G -> DEL N N silent_mutation Average:94.258; most accessible tissue: Zhenshan97 root, score: 98.273 N N N N
vg0425944117 G -> A LOC_Os04g43820.1 upstream_gene_variant ; 34.0bp to feature; MODIFIER silent_mutation Average:94.258; most accessible tissue: Zhenshan97 root, score: 98.273 N N N N
vg0425944117 G -> A LOC_Os04g43810.1 downstream_gene_variant ; 2447.0bp to feature; MODIFIER silent_mutation Average:94.258; most accessible tissue: Zhenshan97 root, score: 98.273 N N N N
vg0425944117 G -> A LOC_Os04g43824.1 downstream_gene_variant ; 475.0bp to feature; MODIFIER silent_mutation Average:94.258; most accessible tissue: Zhenshan97 root, score: 98.273 N N N N
vg0425944117 G -> A LOC_Os04g43820-LOC_Os04g43824 intergenic_region ; MODIFIER silent_mutation Average:94.258; most accessible tissue: Zhenshan97 root, score: 98.273 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0425944117 G A 0.04 0.02 0.01 -0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0425944117 5.62E-12 4.96E-19 Awn_length All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0425944117 1.10E-06 2.44E-17 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0425944117 9.91E-06 3.22E-20 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0425944117 NA 2.58E-17 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0425944117 NA 1.77E-15 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0425944117 NA 6.86E-14 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0425944117 NA 4.21E-09 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 1.19E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 1.61E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 5.32E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 3.00E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 8.02E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 6.36E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 1.08E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 3.69E-08 NA mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 4.64E-09 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 3.48E-06 mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 2.56E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 3.10E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 4.87E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 2.12E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 3.96E-09 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 6.91E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 3.01E-07 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 6.03E-08 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 1.76E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 1.31E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 9.94E-06 mr1576_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 1.49E-12 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 8.27E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 1.81E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 5.82E-12 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 9.86E-07 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 2.67E-10 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 1.00E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425944117 NA 1.03E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251