\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0425465226:

Variant ID: vg0425465226 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 25465226
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


GGAAGGATTTGCTAACTGACCTTATGCTAGTGCCTGCTGGGTAGGACTCGATAGTCAACATTATGTTCTCTTTCATTCATTTACAGTTTGCCAAATGCCT[G/A]
GTTTCAAAGAGTGCTAGCATTGTGGTACATTTTGATTTATGTTATGTTTACCTGAATATTTCCAAATTGAATGCAGACTAAATCCTGAGAGGTTGGGTGG

Reverse complement sequence

CCACCCAACCTCTCAGGATTTAGTCTGCATTCAATTTGGAAATATTCAGGTAAACATAACATAAATCAAAATGTACCACAATGCTAGCACTCTTTGAAAC[C/T]
AGGCATTTGGCAAACTGTAAATGAATGAAAGAGAACATAATGTTGACTATCGAGTCCTACCCAGCAGGCACTAGCATAAGGTCAGTTAGCAAATCCTTCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.20% 12.00% 2.81% 0.00% NA
All Indica  2759 97.40% 0.80% 1.88% 0.00% NA
All Japonica  1512 60.60% 34.50% 4.89% 0.00% NA
Aus  269 98.90% 0.40% 0.74% 0.00% NA
Indica I  595 94.50% 1.70% 3.87% 0.00% NA
Indica II  465 97.80% 0.90% 1.29% 0.00% NA
Indica III  913 99.70% 0.00% 0.33% 0.00% NA
Indica Intermediate  786 96.60% 0.90% 2.54% 0.00% NA
Temperate Japonica  767 30.20% 62.50% 7.30% 0.00% NA
Tropical Japonica  504 95.60% 2.60% 1.79% 0.00% NA
Japonica Intermediate  241 84.20% 12.00% 3.73% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 83.30% 11.10% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0425465226 G -> A LOC_Os04g43040.1 downstream_gene_variant ; 3359.0bp to feature; MODIFIER silent_mutation Average:54.672; most accessible tissue: Callus, score: 87.319 N N N N
vg0425465226 G -> A LOC_Os04g43040.2 downstream_gene_variant ; 3447.0bp to feature; MODIFIER silent_mutation Average:54.672; most accessible tissue: Callus, score: 87.319 N N N N
vg0425465226 G -> A LOC_Os04g43040.3 downstream_gene_variant ; 3447.0bp to feature; MODIFIER silent_mutation Average:54.672; most accessible tissue: Callus, score: 87.319 N N N N
vg0425465226 G -> A LOC_Os04g43030.1 intron_variant ; MODIFIER silent_mutation Average:54.672; most accessible tissue: Callus, score: 87.319 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0425465226 NA 1.57E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0425465226 NA 1.10E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0425465226 NA 1.10E-16 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0425465226 NA 6.62E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0425465226 NA 9.39E-06 mr1010 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 3.16E-06 2.05E-23 mr1163 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 NA 3.21E-11 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 NA 1.54E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 NA 2.10E-11 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 NA 2.28E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 NA 1.51E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 NA 2.90E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 NA 1.87E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 NA 3.92E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 NA 4.38E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 NA 6.83E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 NA 2.50E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 NA 1.42E-09 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 NA 7.24E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 NA 1.46E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 NA 3.63E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 NA 9.06E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 NA 8.43E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 NA 9.34E-08 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 NA 1.07E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 NA 9.80E-07 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 NA 4.34E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226 NA 6.01E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251