Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0425465226:

Variant ID: vg0425465226 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 25465226
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

GGAAGGATTTGCTAACTGACCTTATGCTAGTGCCTGCTGGGTAGGACTCGATAGTCAACATTATGTTCTCTTTCATTCATTTACAGTTTGCCAAATGCCT[G/A]
GTTTCAAAGAGTGCTAGCATTGTGGTACATTTTGATTTATGTTATGTTTACCTGAATATTTCCAAATTGAATGCAGACTAAATCCTGAGAGGTTGGGTGG

Reverse complement sequence

CCACCCAACCTCTCAGGATTTAGTCTGCATTCAATTTGGAAATATTCAGGTAAACATAACATAAATCAAAATGTACCACAATGCTAGCACTCTTTGAAAC[C/T]
AGGCATTTGGCAAACTGTAAATGAATGAAAGAGAACATAATGTTGACTATCGAGTCCTACCCAGCAGGCACTAGCATAAGGTCAGTTAGCAAATCCTTCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.20%	12.00%	2.81%	0.00%	NA
All Indica	2759	97.40%	0.80%	1.88%	0.00%	NA
All Japonica	1512	60.60%	34.50%	4.89%	0.00%	NA
Aus	269	98.90%	0.40%	0.74%	0.00%	NA
Indica I	595	94.50%	1.70%	3.87%	0.00%	NA
Indica II	465	97.80%	0.90%	1.29%	0.00%	NA
Indica III	913	99.70%	0.00%	0.33%	0.00%	NA
Indica Intermediate	786	96.60%	0.90%	2.54%	0.00%	NA
Temperate Japonica	767	30.20%	62.50%	7.30%	0.00%	NA
Tropical Japonica	504	95.60%	2.60%	1.79%	0.00%	NA
Japonica Intermediate	241	84.20%	12.00%	3.73%	0.00%	NA
VI/Aromatic	96	87.50%	12.50%	0.00%	0.00%	NA
Intermediate	90	83.30%	11.10%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0425465226	G -> A	LOC_Os04g43040.1	downstream_gene_variant ; 3359.0bp to feature; MODIFIER	silent_mutation	Average:54.672; most accessible tissue: Callus, score: 87.319	N	N	N	N
vg0425465226	G -> A	LOC_Os04g43040.2	downstream_gene_variant ; 3447.0bp to feature; MODIFIER	silent_mutation	Average:54.672; most accessible tissue: Callus, score: 87.319	N	N	N	N
vg0425465226	G -> A	LOC_Os04g43040.3	downstream_gene_variant ; 3447.0bp to feature; MODIFIER	silent_mutation	Average:54.672; most accessible tissue: Callus, score: 87.319	N	N	N	N
vg0425465226	G -> A	LOC_Os04g43030.1	intron_variant ; MODIFIER	silent_mutation	Average:54.672; most accessible tissue: Callus, score: 87.319	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0425465226	NA	1.57E-10	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0425465226	NA	1.10E-10	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0425465226	NA	1.10E-16	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0425465226	NA	6.62E-13	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0425465226	NA	9.39E-06	mr1010	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	3.16E-06	2.05E-23	mr1163	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	NA	3.21E-11	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	NA	1.54E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	NA	2.10E-11	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	NA	2.28E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	NA	1.51E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	NA	2.90E-07	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	NA	1.87E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	NA	3.92E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	NA	4.38E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	NA	6.83E-07	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	NA	2.50E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	NA	1.42E-09	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	NA	7.24E-07	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	NA	1.46E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	NA	3.63E-07	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	NA	9.06E-08	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	NA	8.43E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	NA	9.34E-08	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	NA	1.07E-07	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	NA	9.80E-07	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	NA	4.34E-08	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425465226	NA	6.01E-07	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251