\
| Variant ID: vg0423591420 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 23591420 |
| Reference Allele: T | Alternative Allele: C,G |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 122. )
GGCGGGGTGTATAAGAGTATAGTTGCAGAGCCGCCGACGGTTGACGGGACTTCTAGAAAATTAAAAATGAATTAAAAATAAAGAGTAGGCGACCGACGGG[T/C,G]
TGTAGAGGGGCATAGTGGCATCGTTTGATGGGACTTCTAAAAATTATAAAAAATGAAACTACAAGTCCAATTTTTAAAGGTTCGTAACTTCCAAAAAGTA
TACTTTTTGGAAGTTACGAACCTTTAAAAATTGGACTTGTAGTTTCATTTTTTATAATTTTTAGAAGTCCCATCAAACGATGCCACTATGCCCCTCTACA[A/G,C]
CCCGTCGGTCGCCTACTCTTTATTTTTAATTCATTTTTAATTTTCTAGAAGTCCCGTCAACCGTCGGCGGCTCTGCAACTATACTCTTATACACCCCGCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.70% | 21.20% | 1.04% | 0.00% | G: 0.02% |
| All Indica | 2759 | 79.80% | 19.80% | 0.40% | 0.00% | G: 0.04% |
| All Japonica | 1512 | 69.20% | 28.30% | 2.51% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 23.90% | 75.60% | 0.50% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.00% | 0.00% | G: 0.11% |
| Indica Intermediate | 786 | 88.70% | 10.40% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 47.50% | 48.40% | 4.17% | 0.00% | NA |
| Tropical Japonica | 504 | 96.40% | 3.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 81.30% | 17.00% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0423591420 | T -> C | LOC_Os04g39570.1 | upstream_gene_variant ; 4232.0bp to feature; MODIFIER | silent_mutation | Average:34.399; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0423591420 | T -> C | LOC_Os04g39570-LOC_Os04g39580 | intergenic_region ; MODIFIER | silent_mutation | Average:34.399; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0423591420 | T -> G | LOC_Os04g39570.1 | upstream_gene_variant ; 4232.0bp to feature; MODIFIER | silent_mutation | Average:34.399; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0423591420 | T -> G | LOC_Os04g39570-LOC_Os04g39580 | intergenic_region ; MODIFIER | silent_mutation | Average:34.399; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0423591420 | NA | 6.35E-21 | Heading_date | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0423591420 | NA | 9.05E-14 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0423591420 | NA | 3.04E-06 | mr1035 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423591420 | NA | 2.72E-06 | mr1136 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423591420 | NA | 9.07E-07 | mr1272 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423591420 | NA | 2.47E-06 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423591420 | NA | 4.23E-06 | mr1745 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423591420 | NA | 7.47E-07 | mr1904 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423591420 | NA | 4.40E-06 | mr1659_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423591420 | NA | 6.87E-08 | mr1904_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |