Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0423591420:

Variant ID: vg0423591420 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 23591420
Reference Allele: T	Alternative Allele: C,G
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

GGCGGGGTGTATAAGAGTATAGTTGCAGAGCCGCCGACGGTTGACGGGACTTCTAGAAAATTAAAAATGAATTAAAAATAAAGAGTAGGCGACCGACGGG[T/C,G]
TGTAGAGGGGCATAGTGGCATCGTTTGATGGGACTTCTAAAAATTATAAAAAATGAAACTACAAGTCCAATTTTTAAAGGTTCGTAACTTCCAAAAAGTA

Reverse complement sequence

TACTTTTTGGAAGTTACGAACCTTTAAAAATTGGACTTGTAGTTTCATTTTTTATAATTTTTAGAAGTCCCATCAAACGATGCCACTATGCCCCTCTACA[A/G,C]
CCCGTCGGTCGCCTACTCTTTATTTTTAATTCATTTTTAATTTTCTAGAAGTCCCGTCAACCGTCGGCGGCTCTGCAACTATACTCTTATACACCCCGCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.70%	21.20%	1.04%	0.00%	G: 0.02%
All Indica	2759	79.80%	19.80%	0.40%	0.00%	G: 0.04%
All Japonica	1512	69.20%	28.30%	2.51%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	23.90%	75.60%	0.50%	0.00%	NA
Indica II	465	96.80%	3.00%	0.22%	0.00%	NA
Indica III	913	99.90%	0.00%	0.00%	0.00%	G: 0.11%
Indica Intermediate	786	88.70%	10.40%	0.89%	0.00%	NA
Temperate Japonica	767	47.50%	48.40%	4.17%	0.00%	NA
Tropical Japonica	504	96.40%	3.20%	0.40%	0.00%	NA
Japonica Intermediate	241	81.30%	17.00%	1.66%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0423591420	T -> C	LOC_Os04g39570.1	upstream_gene_variant ; 4232.0bp to feature; MODIFIER	silent_mutation	Average:34.399; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0423591420	T -> C	LOC_Os04g39570-LOC_Os04g39580	intergenic_region ; MODIFIER	silent_mutation	Average:34.399; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0423591420	T -> G	LOC_Os04g39570.1	upstream_gene_variant ; 4232.0bp to feature; MODIFIER	silent_mutation	Average:34.399; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0423591420	T -> G	LOC_Os04g39570-LOC_Os04g39580	intergenic_region ; MODIFIER	silent_mutation	Average:34.399; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0423591420	NA	6.35E-21	Heading_date	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0423591420	NA	9.05E-14	Heading_date	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0423591420	NA	3.04E-06	mr1035	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423591420	NA	2.72E-06	mr1136	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423591420	NA	9.07E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423591420	NA	2.47E-06	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423591420	NA	4.23E-06	mr1745	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423591420	NA	7.47E-07	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423591420	NA	4.40E-06	mr1659_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423591420	NA	6.87E-08	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251