Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0420279302:

Variant ID: vg0420279302 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20279302
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.71, T: 0.30, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


TAACCAGTACAATTTGCATTTATACATAGGCTCCACCCCCAACTTCCAACTTTCCATCACATCACATCACATCCAAAACTTTCCTACACACATAAACTCC[T/C]
AACTTTTTTTTTTCCAAACTACCAACTTTCCCCAAACTTTCAACTTTTTTCAGTAACTAAACACAGTCATAGCTGCGAGTCTAATGTGAGATCCAGGAAG

Reverse complement sequence

CTTCCTGGATCTCACATTAGACTCGCAGCTATGACTGTGTTTAGTTACTGAAAAAAGTTGAAAGTTTGGGGAAAGTTGGTAGTTTGGAAAAAAAAAAGTT[A/G]
GGAGTTTATGTGTGTAGGAAAGTTTTGGATGTGATGTGATGTGATGGAAAGTTGGAAGTTGGGGGTGGAGCCTATGTATAAATGCAAATTGTACTGGTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.70% 19.20% 0.11% 0.00% NA
All Indica  2759 96.20% 3.70% 0.11% 0.00% NA
All Japonica  1512 59.10% 40.70% 0.13% 0.00% NA
Aus  269 44.20% 55.80% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 95.20% 4.70% 0.11% 0.00% NA
Indica Intermediate  786 93.80% 6.00% 0.25% 0.00% NA
Temperate Japonica  767 22.60% 77.20% 0.26% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 90.90% 9.10% 0.00% 0.00% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420279302 T -> C LOC_Os04g33510.1 3_prime_UTR_variant ; 217.0bp to feature; MODIFIER silent_mutation Average:61.737; most accessible tissue: Callus, score: 85.816 N N N N
vg0420279302 T -> C LOC_Os04g33510.2 3_prime_UTR_variant ; 217.0bp to feature; MODIFIER silent_mutation Average:61.737; most accessible tissue: Callus, score: 85.816 N N N N
vg0420279302 T -> C LOC_Os04g33520.1 upstream_gene_variant ; 1058.0bp to feature; MODIFIER silent_mutation Average:61.737; most accessible tissue: Callus, score: 85.816 N N N N
vg0420279302 T -> C LOC_Os04g33530.1 downstream_gene_variant ; 4132.0bp to feature; MODIFIER silent_mutation Average:61.737; most accessible tissue: Callus, score: 85.816 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420279302 NA 4.69E-15 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0420279302 NA 6.59E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0420279302 NA 1.02E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0420279302 NA 1.31E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0420279302 NA 6.27E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 3.12E-09 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 1.33E-08 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 8.47E-07 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 4.11E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 2.91E-07 mr1318 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 6.38E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 4.78E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 7.79E-06 mr1438 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 8.30E-09 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 3.65E-10 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 4.75E-14 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 1.19E-08 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 2.87E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 8.28E-06 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 7.71E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 5.62E-07 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 6.83E-06 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 1.03E-07 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 1.30E-24 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 5.52E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 1.45E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 3.39E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 4.31E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 2.17E-14 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 4.70E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 6.49E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 1.27E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 1.58E-10 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 2.07E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 2.30E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 5.44E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 2.83E-08 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 5.35E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 1.70E-06 1.70E-06 mr1994 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 2.63E-06 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 6.58E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 3.03E-07 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 1.89E-11 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 2.35E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 1.04E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 2.25E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 1.33E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 1.70E-09 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 2.38E-09 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 1.07E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420279302 NA 1.30E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251