\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418596045:

Variant ID: vg0418596045 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 18596045
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGAGACGAGAGGGAGAAGGGTGCGGCGACGGGTTTGGGGAGTTAAGTAGTGGGCGTTATTTTGCGAAAAAGTCCCTACGCTTTAACTTTTTACATATA[A/G]
GTCCCTATCCGGGAATTCTCCTCCATAAATACTGTTCGTGTGGGGCATATACGTAATTATAGAAAATCGGAGGGCTTTTTTGGAAAAAATTCCACCCAGC

Reverse complement sequence

GCTGGGTGGAATTTTTTCCAAAAAAGCCCTCCGATTTTCTATAATTACGTATATGCCCCACACGAACAGTATTTATGGAGGAGAATTCCCGGATAGGGAC[T/C]
TATATGTAAAAAGTTAAAGCGTAGGGACTTTTTCGCAAAATAACGCCCACTACTTAACTCCCCAAACCCGTCGCCGCACCCTTCTCCCTCTCGTCTCTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.70% 8.20% 1.71% 47.42% NA
All Indica  2759 19.20% 2.50% 1.81% 76.48% NA
All Japonica  1512 77.20% 20.80% 1.79% 0.20% NA
Aus  269 61.00% 0.00% 0.00% 39.03% NA
Indica I  595 28.90% 5.20% 5.55% 60.34% NA
Indica II  465 37.60% 5.60% 0.86% 55.91% NA
Indica III  913 2.70% 0.00% 0.22% 97.04% NA
Indica Intermediate  786 20.00% 1.70% 1.40% 76.97% NA
Temperate Japonica  767 58.30% 38.60% 3.13% 0.00% NA
Tropical Japonica  504 98.40% 0.40% 0.60% 0.60% NA
Japonica Intermediate  241 92.90% 7.10% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 2.10% 1.04% 4.17% NA
Intermediate  90 74.40% 1.10% 3.33% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0418596045 A -> DEL N N silent_mutation Average:61.588; most accessible tissue: Zhenshan97 panicle, score: 99.709 N N N N
vg0418596045 A -> G LOC_Os04g31090.1 upstream_gene_variant ; 1977.0bp to feature; MODIFIER silent_mutation Average:61.588; most accessible tissue: Zhenshan97 panicle, score: 99.709 N N N N
vg0418596045 A -> G LOC_Os04g31110.1 upstream_gene_variant ; 2822.0bp to feature; MODIFIER silent_mutation Average:61.588; most accessible tissue: Zhenshan97 panicle, score: 99.709 N N N N
vg0418596045 A -> G LOC_Os04g31090-LOC_Os04g31110 intergenic_region ; MODIFIER silent_mutation Average:61.588; most accessible tissue: Zhenshan97 panicle, score: 99.709 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0418596045 A G 0.03 0.03 0.02 0.03 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0418596045 1.04E-06 NA Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0418596045 NA 1.59E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0418596045 7.49E-06 7.49E-06 mr1343 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418596045 NA 8.71E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418596045 NA 3.67E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418596045 NA 1.49E-09 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418596045 NA 9.94E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418596045 NA 2.47E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418596045 NA 3.63E-07 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418596045 NA 5.93E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418596045 6.11E-09 NA mr1768_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418596045 NA 4.07E-08 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418596045 NA 3.06E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251