Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418596045:

Variant ID: vg0418596045 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 18596045
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

GGAGAGACGAGAGGGAGAAGGGTGCGGCGACGGGTTTGGGGAGTTAAGTAGTGGGCGTTATTTTGCGAAAAAGTCCCTACGCTTTAACTTTTTACATATA[A/G]
GTCCCTATCCGGGAATTCTCCTCCATAAATACTGTTCGTGTGGGGCATATACGTAATTATAGAAAATCGGAGGGCTTTTTTGGAAAAAATTCCACCCAGC

Reverse complement sequence

GCTGGGTGGAATTTTTTCCAAAAAAGCCCTCCGATTTTCTATAATTACGTATATGCCCCACACGAACAGTATTTATGGAGGAGAATTCCCGGATAGGGAC[T/C]
TATATGTAAAAAGTTAAAGCGTAGGGACTTTTTCGCAAAATAACGCCCACTACTTAACTCCCCAAACCCGTCGCCGCACCCTTCTCCCTCTCGTCTCTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.70%	8.20%	1.71%	47.42%	NA
All Indica	2759	19.20%	2.50%	1.81%	76.48%	NA
All Japonica	1512	77.20%	20.80%	1.79%	0.20%	NA
Aus	269	61.00%	0.00%	0.00%	39.03%	NA
Indica I	595	28.90%	5.20%	5.55%	60.34%	NA
Indica II	465	37.60%	5.60%	0.86%	55.91%	NA
Indica III	913	2.70%	0.00%	0.22%	97.04%	NA
Indica Intermediate	786	20.00%	1.70%	1.40%	76.97%	NA
Temperate Japonica	767	58.30%	38.60%	3.13%	0.00%	NA
Tropical Japonica	504	98.40%	0.40%	0.60%	0.60%	NA
Japonica Intermediate	241	92.90%	7.10%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	2.10%	1.04%	4.17%	NA
Intermediate	90	74.40%	1.10%	3.33%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0418596045	A -> DEL	N	N	silent_mutation	Average:61.588; most accessible tissue: Zhenshan97 panicle, score: 99.709	N	N	N	N
vg0418596045	A -> G	LOC_Os04g31090.1	upstream_gene_variant ; 1977.0bp to feature; MODIFIER	silent_mutation	Average:61.588; most accessible tissue: Zhenshan97 panicle, score: 99.709	N	N	N	N
vg0418596045	A -> G	LOC_Os04g31110.1	upstream_gene_variant ; 2822.0bp to feature; MODIFIER	silent_mutation	Average:61.588; most accessible tissue: Zhenshan97 panicle, score: 99.709	N	N	N	N
vg0418596045	A -> G	LOC_Os04g31090-LOC_Os04g31110	intergenic_region ; MODIFIER	silent_mutation	Average:61.588; most accessible tissue: Zhenshan97 panicle, score: 99.709	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0418596045	A	G	0.03	0.03	0.02	0.03	0.02	0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0418596045	1.04E-06	NA	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0418596045	NA	1.59E-10	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0418596045	7.49E-06	7.49E-06	mr1343	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418596045	NA	8.71E-06	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418596045	NA	3.67E-06	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418596045	NA	1.49E-09	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418596045	NA	9.94E-07	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418596045	NA	2.47E-06	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418596045	NA	3.63E-07	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418596045	NA	5.93E-06	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418596045	6.11E-09	NA	mr1768_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418596045	NA	4.07E-08	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418596045	NA	3.06E-06	mr1780_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251