\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417872342:

Variant ID: vg0417872342 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 17872342
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:


GTGCTTTACACAAATCCAGTCTATGACACCCTGCATTAATTCCATTTCATTACATATTACAACTTTTGTACCCAAGAAGGAGATGTGCCCAAGAAGGAGA[T/C]
GCACGGGCGCGTGGCGGCAAAGCGGTGGAGATGTGGGGGCGCGCAGTGGTCGCGCTCTGCAATGCAGCTACGGCGCTACGCTAGGGCGGCAGAGGGATGA

Reverse complement sequence

TCATCCCTCTGCCGCCCTAGCGTAGCGCCGTAGCTGCATTGCAGAGCGCGACCACTGCGCGCCCCCACATCTCCACCGCTTTGCCGCCACGCGCCCGTGC[A/G]
TCTCCTTCTTGGGCACATCTCCTTCTTGGGTACAAAAGTTGTAATATGTAATGAAATGGAATTAATGCAGGGTGTCATAGACTGGATTTGTGTAAAGCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.40% 29.50% 0.74% 25.33% NA
All Indica  2759 50.50% 34.20% 0.43% 14.90% NA
All Japonica  1512 35.10% 13.80% 0.79% 50.26% NA
Aus  269 37.20% 59.10% 3.35% 0.37% NA
Indica I  595 3.50% 67.70% 0.34% 28.40% NA
Indica II  465 58.70% 9.50% 0.65% 31.18% NA
Indica III  913 74.00% 25.20% 0.66% 0.11% NA
Indica Intermediate  786 53.80% 33.80% 0.13% 12.21% NA
Temperate Japonica  767 3.30% 10.80% 1.43% 84.49% NA
Tropical Japonica  504 70.40% 20.60% 0.20% 8.73% NA
Japonica Intermediate  241 62.70% 9.10% 0.00% 28.22% NA
VI/Aromatic  96 38.50% 58.30% 2.08% 1.04% NA
Intermediate  90 41.10% 32.20% 0.00% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0417872342 T -> C LOC_Os04g29950.1 upstream_gene_variant ; 3571.0bp to feature; MODIFIER silent_mutation Average:72.699; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N
vg0417872342 T -> C LOC_Os04g29960.1 downstream_gene_variant ; 1971.0bp to feature; MODIFIER silent_mutation Average:72.699; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N
vg0417872342 T -> C LOC_Os04g29950-LOC_Os04g29960 intergenic_region ; MODIFIER silent_mutation Average:72.699; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N
vg0417872342 T -> DEL N N silent_mutation Average:72.699; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0417872342 T C 0.02 0.01 0.0 0.02 0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0417872342 NA 1.61E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0417872342 NA 1.77E-09 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0417872342 NA 1.48E-06 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 1.11E-06 mr1263 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 9.92E-16 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 1.11E-06 mr1451 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 1.68E-11 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 2.00E-06 mr1550 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 1.72E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 8.22E-06 mr1689 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 1.96E-09 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 2.33E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 6.57E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 2.80E-12 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 6.76E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 2.76E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 6.20E-09 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 3.85E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 2.81E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 8.65E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 5.94E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 2.37E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 4.85E-06 NA mr1277_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 6.72E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 6.06E-11 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 2.30E-06 mr1550_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 2.52E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 1.07E-06 mr1668_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 4.34E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 4.47E-06 NA mr1746_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 1.23E-09 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 1.54E-11 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417872342 NA 1.81E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251