Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403330359:

Variant ID: vg0403330359 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3330359
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTTAACTCGGTGCTCAGTCTAGTCCTGAACAAAAGGACACGGATAGAGATAGATGAAGTCGTTGCGACGATGGATATCTCTAAGGCAAATGAAGGCTAC[G/A]
CGAGCTGCGGCTCGGTAATCGAGATGTCTAGGCAAATGAAGGCTACAAGGGCCGGTGTCCGTTAGTCGAGATGCCATGGCACTCGACTAGTACGCGGGTG

Reverse complement sequence

CACCCGCGTACTAGTCGAGTGCCATGGCATCTCGACTAACGGACACCGGCCCTTGTAGCCTTCATTTGCCTAGACATCTCGATTACCGAGCCGCAGCTCG[C/T]
GTAGCCTTCATTTGCCTTAGAGATATCCATCGTCGCAACGACTTCATCTATCTCTATCCGTGTCCTTTTGTTCAGGACTAGACTGAGCACCGAGTTAAGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.10%	2.00%	9.44%	41.47%	NA
All Indica	2759	37.80%	0.00%	3.77%	58.39%	NA
All Japonica	1512	61.20%	6.20%	15.81%	16.87%	NA
Aus	269	51.30%	0.00%	33.83%	14.87%	NA
Indica I	595	40.30%	0.00%	2.86%	56.81%	NA
Indica II	465	48.00%	0.00%	3.66%	48.39%	NA
Indica III	913	27.40%	0.00%	5.15%	67.47%	NA
Indica Intermediate	786	42.10%	0.00%	2.93%	54.96%	NA
Temperate Japonica	767	80.40%	11.50%	2.22%	5.87%	NA
Tropical Japonica	504	34.90%	0.40%	35.52%	29.17%	NA
Japonica Intermediate	241	54.80%	1.20%	17.84%	26.14%	NA
VI/Aromatic	96	71.90%	0.00%	5.21%	22.92%	NA
Intermediate	90	55.60%	1.10%	7.78%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403330359	G -> DEL	N	N	silent_mutation	Average:35.768; most accessible tissue: Minghui63 young leaf, score: 75.479	N	N	N	N
vg0403330359	G -> A	LOC_Os04g06360.1	downstream_gene_variant ; 4004.0bp to feature; MODIFIER	silent_mutation	Average:35.768; most accessible tissue: Minghui63 young leaf, score: 75.479	N	N	N	N
vg0403330359	G -> A	LOC_Os04g06374.1	downstream_gene_variant ; 3511.0bp to feature; MODIFIER	silent_mutation	Average:35.768; most accessible tissue: Minghui63 young leaf, score: 75.479	N	N	N	N
vg0403330359	G -> A	LOC_Os04g06360-LOC_Os04g06374	intergenic_region ; MODIFIER	silent_mutation	Average:35.768; most accessible tissue: Minghui63 young leaf, score: 75.479	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403330359	NA	4.55E-14	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0403330359	NA	8.27E-10	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0403330359	NA	6.79E-12	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0403330359	NA	1.17E-06	mr1004	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403330359	NA	8.06E-06	mr1005	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403330359	4.37E-06	NA	mr1215	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403330359	NA	1.14E-08	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403330359	NA	2.60E-09	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403330359	NA	2.66E-08	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403330359	NA	7.54E-06	mr1723_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403330359	NA	2.72E-08	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251